This Mortal Coil

This Mortal Coil

Catarina Agatta is a hacker. She can cripple mainframes and crash through firewalls, but that?s not what makes her special. In Cat?s world, people are implanted with technology to recode their DNA, allowing them to change their bodies in any way they want. And Cat happens to be a gene-hacking genius. That?s no surprise, since Cat?s father is Dr. Lachlan Agatta, a legendary Catarina Agatta is a hacker. She can cripple mainframes and crash through firewalls, but that?s not what mak...

DownloadRead Online
Title:This Mortal Coil
Author:Emily Suvada
Rating:
Genres:Science Fiction
ISBN:This Mortal Coil
ISBN
Edition Language:English
Format Type:Hardcover
Number of Pages:425 pages pages

This Mortal Coil Reviews

  • Scrill
    May 11, 2018

    Emily Suvada has written a brilliant dystopian science fiction thriller set in a future where humanity is threatened by a deadly plague that has people exploding into toxic Hydra clouds. Catarina Agatta is a talented hacker, 'bobcat', working with The Skies resistance movement against ...

    2 1/2 stars. This was? interesting, and also not my type of book, and kind of disappointing. I honestly think This Mortal Coil is bit of your typical plot-twisty-but-not-very-quality YA sci-fi , and although some things stood out, I just didn?t love it. The obvious upside of th...

    ?There?s no such thing quite as dangerous as an Agatta?s best intentions.? The beginning was intense and fast-paced but as it went on, the book really lost stream. Of course the length doesn?t help (420 pages) but it went off the rail for me when her martyrdom kicked in. I...

    3.5* A world where a disease has taken over and people have tech installed in their bodies. It's fast paced, action packed, heavy on romance, and decently entertaining. Cool and unique world. I want to make it clear that it's DECENTLY ENTERTAINING and that there are a ton of books t...

    ((2.5 stars, rounded up for THAT plot twist)) hoo boy this is going to be a bitch of a review to write. i don't think i've ever been so conflicted about a book in a while. i'll start with the stuff i liked first. the plot and the concept was excellent. there have been no shorta...

    Who is this cover and where can I marry it???? ...

    This book was fantastic! At first, it seemed a bit cliched and stuff, but then it picked up and I couldn't put it down Genetics, coding, technology, big plot twists, fast paced, everything you could want in a sci-fi book Y you can tell the author researched it all and knew what ...

    I finished this book a while ago and totally forgot to write a review for it OOPS ITS FINE Basically, this book was beyond fun and sooOoOO interesting guys. It gave me slight The Darkest Minds vibes and I?m not really sure why it just did xD it?s like a sci-fi tech version of T...

    A great science fiction blend of post apocalyptic survival and genetic technology. It's like Warcross meets The Walking Dead. At times I thought this was just plain weird, and it is, but I enjoyed it. Content: Cannibalism. Plague/infection. Brutal descriptions of injury and self ...

    Actual rating 4.5 stars. I have read a slew of post-apocalyptic novels in which a deadly virus has wreaked havoc and culled the majority of our species. What ordinarily happens is that a portion of humanity devolves into zombie-like creatures, another into opportunistic gangs, and a...

    Checkout my full review + giveaway (ends 11/12) on my blog! http://omgbooksandmorebooks.blogspot.... THIS BOOK! In my opinion this should be required reading for science classes because the science level in this book is beyond from what I've seen in any YA book. It's amazing. The ca...

    this was much better than I expected (sorry for saying nothing else about this book but I currently have no power and shitty reception and an injured dog so that?s all for now) ...

    THIS REVIEW (AND MANY OTHERS) ARE ON MY BLOG Thank you Penguin Australia for sending me a review copy. All thoughts are my own. R A M B L E I went into this book with some low expectations. I?m not exactly sure why. I had requested it from Penguin a few months prior and had ...

    I received a copy of this book in exchange for an honest review. 3.5 stars. If your father was responsible for the apocalypse would you try to set it right? That's the dilemma Catarina faces when a mysterious man shows up at her cabin after a virus wiped out most of humanity, and...

    The earth is a desolate wasteland, a virus decimating humanity, survivors abandoned to starvation. Catarina Agatta is a survivor. Catarina is the seventeen year old daughter of the renowned geneticist Lachlan Agatta, a magnate and former Cartaxus programmer and genetic engineer, now re...

    Not bad at all. Was so into this book but there was so much underlying and bringing the girl Cole is missing up that you have a feeling what is coming when the big twist is revealed. As for some of the other characters, I honestly had a love hate with some, like Dax. However, this was ...

    4.5 stars Excellent. I loved the worldbuilding with all the built-in tech that people have for "genehacking". It was both brilliant and scary. The story was exciting and fast-paced, and I didn't see the ending coming. I'm absolutely in for the next book. ...

    Ahhhhh..... well this seems to be a polarizing kind of book. My GR feed: "This book is my favorite/coolest sci-fi of this year/all time" Also my GR feed: "This has flat characters and a love triangle and is very slow..." What to do? Try it I guess.... So I did and I dislike virus bo...

    4.5 stars Wow, this was a blast! (You know, because the Hydra virus makes you blow up and stuff? ... no? Screw you, that was funny.) This Mortal Coil was such an insane ride from start to finish. It was wild, it was gruesome, it was bloody and fantastic and bloody fantastic. You ...

    3.5 stars - I loved the plot - it did feel like your average dystopian, but the idea of the virus was so original and the plot twists and tech made it feel different - the twists and turns kept you wanting to read more and more - the tech was so so cool? I loved reading about tha...

    why do authors always ruin great premises with instalove and tropes ?? ...

    I did really enjoy this book and can't wait to pick up the next book. Something I did struggle with was getting into the story. There were times where I was 100% invested in the story but there were times where I wasn't. ...

    TCAGACATACGAGTAATGGATTACAGGTGCGAAGCTGTGGATGTAATAAGGCCATCACGACCGCTGGGACTCATCTATATAGCCATGCACGAGGCCAAGTATAATCCACCAGTCCCACAGACCTTAGCACCAGTTAAAGATAATTGGTACCAACCACCGGTGGCAAGATAGATTATTGCCTTCAAGCAACTCTCCATTAGTGCTACTTACGTCATCACGTGGGATCGTACGCTAGTTTACTAGTTTAATGAGTGGTTGCTGTACTGGCATGGTCGTCAACACGGTC...

    This Mortal Coil by Emily Suvada is a refreshing new dystopia/sci-fi/post-apocalyptic story that grabbed me from the start until the very end, and left me gaspingwith the many twists and turns. What immediately grabbed me from the start and impressed me was the writing style. Fr...

    There?s no gene for Run Like Hell? Or is there? Stop the presses I?ve found my new YA trilogy obsession with Emily Suvada?s ?This Mortal Coil? a fast paced, intricately woven, brilliantly fascinating and best of all intelligent and addictive thriller. Actually I?...

    BANG! Did that roller coaster just stop for a while? Woah! I wasn't prepared for such a fantastically written sci-fi thriller. This book got everything. To name a few, I experienced some razor sharp action, last minute escapes, a lot of seriously great plot twists, powerful dialogues...

    It's been a long time since a book has set my soul ablaze, leaving me anxious to devour its pages but wanting to savor every word. I loved this book with every ounce of my being: this is the epitome of why I love the science fiction genre all wrapped up into one. Fantastically written ...

    ?There?s no such thing as right anymore - that ended when the plague hit. Sometimes we need to do awful things to stop worse things from happening. You?re still thinking in terms of right and wrong, but this is war, and the rules have changed.? This was an interesting no...

    5 Out Of 5 "hacker-if-ic" STARS This book is amazing, one of the best dystopian's I've read in a while and absolutely a new favorite. For a book involving gene hacking, splicing, decoding and lots of technical terms and such this is completely comprehensible and seriously compelli...

    In the future we have learned to change things to our DNA like appearances as well as enhance our bodies through technology implanted into our bodies. Not only that, but through the DNA recoding they have been able to cure diseases and viruses such as flus. Until they come across one t...

  • Sara
    Nov 05, 2017

    Emily Suvada has written a brilliant dystopian science fiction thriller set in a future where humanity is threatened by a deadly plague that has people exploding into toxic Hydra clouds. Catarina Agatta is a talented hacker, 'bobcat', working with The Skies resistance movement against ...

    2 1/2 stars. This was? interesting, and also not my type of book, and kind of disappointing. I honestly think This Mortal Coil is bit of your typical plot-twisty-but-not-very-quality YA sci-fi , and although some things stood out, I just didn?t love it. The obvious upside of th...

    ?There?s no such thing quite as dangerous as an Agatta?s best intentions.? The beginning was intense and fast-paced but as it went on, the book really lost stream. Of course the length doesn?t help (420 pages) but it went off the rail for me when her martyrdom kicked in. I...

    3.5* A world where a disease has taken over and people have tech installed in their bodies. It's fast paced, action packed, heavy on romance, and decently entertaining. Cool and unique world. I want to make it clear that it's DECENTLY ENTERTAINING and that there are a ton of books t...

    ((2.5 stars, rounded up for THAT plot twist)) hoo boy this is going to be a bitch of a review to write. i don't think i've ever been so conflicted about a book in a while. i'll start with the stuff i liked first. the plot and the concept was excellent. there have been no shorta...

    Who is this cover and where can I marry it???? ...

    This book was fantastic! At first, it seemed a bit cliched and stuff, but then it picked up and I couldn't put it down Genetics, coding, technology, big plot twists, fast paced, everything you could want in a sci-fi book Y you can tell the author researched it all and knew what ...

    I finished this book a while ago and totally forgot to write a review for it OOPS ITS FINE Basically, this book was beyond fun and sooOoOO interesting guys. It gave me slight The Darkest Minds vibes and I?m not really sure why it just did xD it?s like a sci-fi tech version of T...

    A great science fiction blend of post apocalyptic survival and genetic technology. It's like Warcross meets The Walking Dead. At times I thought this was just plain weird, and it is, but I enjoyed it. Content: Cannibalism. Plague/infection. Brutal descriptions of injury and self ...

    Actual rating 4.5 stars. I have read a slew of post-apocalyptic novels in which a deadly virus has wreaked havoc and culled the majority of our species. What ordinarily happens is that a portion of humanity devolves into zombie-like creatures, another into opportunistic gangs, and a...

    Checkout my full review + giveaway (ends 11/12) on my blog! http://omgbooksandmorebooks.blogspot.... THIS BOOK! In my opinion this should be required reading for science classes because the science level in this book is beyond from what I've seen in any YA book. It's amazing. The ca...

    this was much better than I expected (sorry for saying nothing else about this book but I currently have no power and shitty reception and an injured dog so that?s all for now) ...

    THIS REVIEW (AND MANY OTHERS) ARE ON MY BLOG Thank you Penguin Australia for sending me a review copy. All thoughts are my own. R A M B L E I went into this book with some low expectations. I?m not exactly sure why. I had requested it from Penguin a few months prior and had ...

    I received a copy of this book in exchange for an honest review. 3.5 stars. If your father was responsible for the apocalypse would you try to set it right? That's the dilemma Catarina faces when a mysterious man shows up at her cabin after a virus wiped out most of humanity, and...

  • Suzanne
    Jun 24, 2018

    Emily Suvada has written a brilliant dystopian science fiction thriller set in a future where humanity is threatened by a deadly plague that has people exploding into toxic Hydra clouds. Catarina Agatta is a talented hacker, 'bobcat', working with The Skies resistance movement against ...

    2 1/2 stars. This was? interesting, and also not my type of book, and kind of disappointing. I honestly think This Mortal Coil is bit of your typical plot-twisty-but-not-very-quality YA sci-fi , and although some things stood out, I just didn?t love it. The obvious upside of th...

    ?There?s no such thing quite as dangerous as an Agatta?s best intentions.? The beginning was intense and fast-paced but as it went on, the book really lost stream. Of course the length doesn?t help (420 pages) but it went off the rail for me when her martyrdom kicked in. I...

    3.5* A world where a disease has taken over and people have tech installed in their bodies. It's fast paced, action packed, heavy on romance, and decently entertaining. Cool and unique world. I want to make it clear that it's DECENTLY ENTERTAINING and that there are a ton of books t...

    ((2.5 stars, rounded up for THAT plot twist)) hoo boy this is going to be a bitch of a review to write. i don't think i've ever been so conflicted about a book in a while. i'll start with the stuff i liked first. the plot and the concept was excellent. there have been no shorta...

    Who is this cover and where can I marry it???? ...

    This book was fantastic! At first, it seemed a bit cliched and stuff, but then it picked up and I couldn't put it down Genetics, coding, technology, big plot twists, fast paced, everything you could want in a sci-fi book Y you can tell the author researched it all and knew what ...

    I finished this book a while ago and totally forgot to write a review for it OOPS ITS FINE Basically, this book was beyond fun and sooOoOO interesting guys. It gave me slight The Darkest Minds vibes and I?m not really sure why it just did xD it?s like a sci-fi tech version of T...

    A great science fiction blend of post apocalyptic survival and genetic technology. It's like Warcross meets The Walking Dead. At times I thought this was just plain weird, and it is, but I enjoyed it. Content: Cannibalism. Plague/infection. Brutal descriptions of injury and self ...

    Actual rating 4.5 stars. I have read a slew of post-apocalyptic novels in which a deadly virus has wreaked havoc and culled the majority of our species. What ordinarily happens is that a portion of humanity devolves into zombie-like creatures, another into opportunistic gangs, and a...

    Checkout my full review + giveaway (ends 11/12) on my blog! http://omgbooksandmorebooks.blogspot.... THIS BOOK! In my opinion this should be required reading for science classes because the science level in this book is beyond from what I've seen in any YA book. It's amazing. The ca...

    this was much better than I expected (sorry for saying nothing else about this book but I currently have no power and shitty reception and an injured dog so that?s all for now) ...

    THIS REVIEW (AND MANY OTHERS) ARE ON MY BLOG Thank you Penguin Australia for sending me a review copy. All thoughts are my own. R A M B L E I went into this book with some low expectations. I?m not exactly sure why. I had requested it from Penguin a few months prior and had ...

    I received a copy of this book in exchange for an honest review. 3.5 stars. If your father was responsible for the apocalypse would you try to set it right? That's the dilemma Catarina faces when a mysterious man shows up at her cabin after a virus wiped out most of humanity, and...

    The earth is a desolate wasteland, a virus decimating humanity, survivors abandoned to starvation. Catarina Agatta is a survivor. Catarina is the seventeen year old daughter of the renowned geneticist Lachlan Agatta, a magnate and former Cartaxus programmer and genetic engineer, now re...

    Not bad at all. Was so into this book but there was so much underlying and bringing the girl Cole is missing up that you have a feeling what is coming when the big twist is revealed. As for some of the other characters, I honestly had a love hate with some, like Dax. However, this was ...

  • Inge
    Oct 15, 2017

    Emily Suvada has written a brilliant dystopian science fiction thriller set in a future where humanity is threatened by a deadly plague that has people exploding into toxic Hydra clouds. Catarina Agatta is a talented hacker, 'bobcat', working with The Skies resistance movement against ...

    2 1/2 stars. This was? interesting, and also not my type of book, and kind of disappointing. I honestly think This Mortal Coil is bit of your typical plot-twisty-but-not-very-quality YA sci-fi , and although some things stood out, I just didn?t love it. The obvious upside of th...

    ?There?s no such thing quite as dangerous as an Agatta?s best intentions.? The beginning was intense and fast-paced but as it went on, the book really lost stream. Of course the length doesn?t help (420 pages) but it went off the rail for me when her martyrdom kicked in. I...

    3.5* A world where a disease has taken over and people have tech installed in their bodies. It's fast paced, action packed, heavy on romance, and decently entertaining. Cool and unique world. I want to make it clear that it's DECENTLY ENTERTAINING and that there are a ton of books t...

    ((2.5 stars, rounded up for THAT plot twist)) hoo boy this is going to be a bitch of a review to write. i don't think i've ever been so conflicted about a book in a while. i'll start with the stuff i liked first. the plot and the concept was excellent. there have been no shorta...

    Who is this cover and where can I marry it???? ...

    This book was fantastic! At first, it seemed a bit cliched and stuff, but then it picked up and I couldn't put it down Genetics, coding, technology, big plot twists, fast paced, everything you could want in a sci-fi book Y you can tell the author researched it all and knew what ...

    I finished this book a while ago and totally forgot to write a review for it OOPS ITS FINE Basically, this book was beyond fun and sooOoOO interesting guys. It gave me slight The Darkest Minds vibes and I?m not really sure why it just did xD it?s like a sci-fi tech version of T...

    A great science fiction blend of post apocalyptic survival and genetic technology. It's like Warcross meets The Walking Dead. At times I thought this was just plain weird, and it is, but I enjoyed it. Content: Cannibalism. Plague/infection. Brutal descriptions of injury and self ...

    Actual rating 4.5 stars. I have read a slew of post-apocalyptic novels in which a deadly virus has wreaked havoc and culled the majority of our species. What ordinarily happens is that a portion of humanity devolves into zombie-like creatures, another into opportunistic gangs, and a...

    Checkout my full review + giveaway (ends 11/12) on my blog! http://omgbooksandmorebooks.blogspot.... THIS BOOK! In my opinion this should be required reading for science classes because the science level in this book is beyond from what I've seen in any YA book. It's amazing. The ca...

    this was much better than I expected (sorry for saying nothing else about this book but I currently have no power and shitty reception and an injured dog so that?s all for now) ...

    THIS REVIEW (AND MANY OTHERS) ARE ON MY BLOG Thank you Penguin Australia for sending me a review copy. All thoughts are my own. R A M B L E I went into this book with some low expectations. I?m not exactly sure why. I had requested it from Penguin a few months prior and had ...

    I received a copy of this book in exchange for an honest review. 3.5 stars. If your father was responsible for the apocalypse would you try to set it right? That's the dilemma Catarina faces when a mysterious man shows up at her cabin after a virus wiped out most of humanity, and...

    The earth is a desolate wasteland, a virus decimating humanity, survivors abandoned to starvation. Catarina Agatta is a survivor. Catarina is the seventeen year old daughter of the renowned geneticist Lachlan Agatta, a magnate and former Cartaxus programmer and genetic engineer, now re...

    Not bad at all. Was so into this book but there was so much underlying and bringing the girl Cole is missing up that you have a feeling what is coming when the big twist is revealed. As for some of the other characters, I honestly had a love hate with some, like Dax. However, this was ...

    4.5 stars Excellent. I loved the worldbuilding with all the built-in tech that people have for "genehacking". It was both brilliant and scary. The story was exciting and fast-paced, and I didn't see the ending coming. I'm absolutely in for the next book. ...

    Ahhhhh..... well this seems to be a polarizing kind of book. My GR feed: "This book is my favorite/coolest sci-fi of this year/all time" Also my GR feed: "This has flat characters and a love triangle and is very slow..." What to do? Try it I guess.... So I did and I dislike virus bo...

    4.5 stars Wow, this was a blast! (You know, because the Hydra virus makes you blow up and stuff? ... no? Screw you, that was funny.) This Mortal Coil was such an insane ride from start to finish. It was wild, it was gruesome, it was bloody and fantastic and bloody fantastic. You ...

  • Jen Ryland
    Oct 29, 2017

    Emily Suvada has written a brilliant dystopian science fiction thriller set in a future where humanity is threatened by a deadly plague that has people exploding into toxic Hydra clouds. Catarina Agatta is a talented hacker, 'bobcat', working with The Skies resistance movement against ...

    2 1/2 stars. This was? interesting, and also not my type of book, and kind of disappointing. I honestly think This Mortal Coil is bit of your typical plot-twisty-but-not-very-quality YA sci-fi , and although some things stood out, I just didn?t love it. The obvious upside of th...

    ?There?s no such thing quite as dangerous as an Agatta?s best intentions.? The beginning was intense and fast-paced but as it went on, the book really lost stream. Of course the length doesn?t help (420 pages) but it went off the rail for me when her martyrdom kicked in. I...

    3.5* A world where a disease has taken over and people have tech installed in their bodies. It's fast paced, action packed, heavy on romance, and decently entertaining. Cool and unique world. I want to make it clear that it's DECENTLY ENTERTAINING and that there are a ton of books t...

    ((2.5 stars, rounded up for THAT plot twist)) hoo boy this is going to be a bitch of a review to write. i don't think i've ever been so conflicted about a book in a while. i'll start with the stuff i liked first. the plot and the concept was excellent. there have been no shorta...

    Who is this cover and where can I marry it???? ...

    This book was fantastic! At first, it seemed a bit cliched and stuff, but then it picked up and I couldn't put it down Genetics, coding, technology, big plot twists, fast paced, everything you could want in a sci-fi book Y you can tell the author researched it all and knew what ...

    I finished this book a while ago and totally forgot to write a review for it OOPS ITS FINE Basically, this book was beyond fun and sooOoOO interesting guys. It gave me slight The Darkest Minds vibes and I?m not really sure why it just did xD it?s like a sci-fi tech version of T...

    A great science fiction blend of post apocalyptic survival and genetic technology. It's like Warcross meets The Walking Dead. At times I thought this was just plain weird, and it is, but I enjoyed it. Content: Cannibalism. Plague/infection. Brutal descriptions of injury and self ...

    Actual rating 4.5 stars. I have read a slew of post-apocalyptic novels in which a deadly virus has wreaked havoc and culled the majority of our species. What ordinarily happens is that a portion of humanity devolves into zombie-like creatures, another into opportunistic gangs, and a...

    Checkout my full review + giveaway (ends 11/12) on my blog! http://omgbooksandmorebooks.blogspot.... THIS BOOK! In my opinion this should be required reading for science classes because the science level in this book is beyond from what I've seen in any YA book. It's amazing. The ca...

    this was much better than I expected (sorry for saying nothing else about this book but I currently have no power and shitty reception and an injured dog so that?s all for now) ...

    THIS REVIEW (AND MANY OTHERS) ARE ON MY BLOG Thank you Penguin Australia for sending me a review copy. All thoughts are my own. R A M B L E I went into this book with some low expectations. I?m not exactly sure why. I had requested it from Penguin a few months prior and had ...

    I received a copy of this book in exchange for an honest review. 3.5 stars. If your father was responsible for the apocalypse would you try to set it right? That's the dilemma Catarina faces when a mysterious man shows up at her cabin after a virus wiped out most of humanity, and...

    The earth is a desolate wasteland, a virus decimating humanity, survivors abandoned to starvation. Catarina Agatta is a survivor. Catarina is the seventeen year old daughter of the renowned geneticist Lachlan Agatta, a magnate and former Cartaxus programmer and genetic engineer, now re...

    Not bad at all. Was so into this book but there was so much underlying and bringing the girl Cole is missing up that you have a feeling what is coming when the big twist is revealed. As for some of the other characters, I honestly had a love hate with some, like Dax. However, this was ...

    4.5 stars Excellent. I loved the worldbuilding with all the built-in tech that people have for "genehacking". It was both brilliant and scary. The story was exciting and fast-paced, and I didn't see the ending coming. I'm absolutely in for the next book. ...

    Ahhhhh..... well this seems to be a polarizing kind of book. My GR feed: "This book is my favorite/coolest sci-fi of this year/all time" Also my GR feed: "This has flat characters and a love triangle and is very slow..." What to do? Try it I guess.... So I did and I dislike virus bo...

  • Trina (Between Chapters)
    Jun 22, 2018

    Emily Suvada has written a brilliant dystopian science fiction thriller set in a future where humanity is threatened by a deadly plague that has people exploding into toxic Hydra clouds. Catarina Agatta is a talented hacker, 'bobcat', working with The Skies resistance movement against ...

    2 1/2 stars. This was? interesting, and also not my type of book, and kind of disappointing. I honestly think This Mortal Coil is bit of your typical plot-twisty-but-not-very-quality YA sci-fi , and although some things stood out, I just didn?t love it. The obvious upside of th...

    ?There?s no such thing quite as dangerous as an Agatta?s best intentions.? The beginning was intense and fast-paced but as it went on, the book really lost stream. Of course the length doesn?t help (420 pages) but it went off the rail for me when her martyrdom kicked in. I...

    3.5* A world where a disease has taken over and people have tech installed in their bodies. It's fast paced, action packed, heavy on romance, and decently entertaining. Cool and unique world. I want to make it clear that it's DECENTLY ENTERTAINING and that there are a ton of books t...

    ((2.5 stars, rounded up for THAT plot twist)) hoo boy this is going to be a bitch of a review to write. i don't think i've ever been so conflicted about a book in a while. i'll start with the stuff i liked first. the plot and the concept was excellent. there have been no shorta...

    Who is this cover and where can I marry it???? ...

    This book was fantastic! At first, it seemed a bit cliched and stuff, but then it picked up and I couldn't put it down Genetics, coding, technology, big plot twists, fast paced, everything you could want in a sci-fi book Y you can tell the author researched it all and knew what ...

    I finished this book a while ago and totally forgot to write a review for it OOPS ITS FINE Basically, this book was beyond fun and sooOoOO interesting guys. It gave me slight The Darkest Minds vibes and I?m not really sure why it just did xD it?s like a sci-fi tech version of T...

    A great science fiction blend of post apocalyptic survival and genetic technology. It's like Warcross meets The Walking Dead. At times I thought this was just plain weird, and it is, but I enjoyed it. Content: Cannibalism. Plague/infection. Brutal descriptions of injury and self ...

  •  ⇝LEAH⇜
    Jul 27, 2018

    Emily Suvada has written a brilliant dystopian science fiction thriller set in a future where humanity is threatened by a deadly plague that has people exploding into toxic Hydra clouds. Catarina Agatta is a talented hacker, 'bobcat', working with The Skies resistance movement against ...

    2 1/2 stars. This was? interesting, and also not my type of book, and kind of disappointing. I honestly think This Mortal Coil is bit of your typical plot-twisty-but-not-very-quality YA sci-fi , and although some things stood out, I just didn?t love it. The obvious upside of th...

    ?There?s no such thing quite as dangerous as an Agatta?s best intentions.? The beginning was intense and fast-paced but as it went on, the book really lost stream. Of course the length doesn?t help (420 pages) but it went off the rail for me when her martyrdom kicked in. I...

    3.5* A world where a disease has taken over and people have tech installed in their bodies. It's fast paced, action packed, heavy on romance, and decently entertaining. Cool and unique world. I want to make it clear that it's DECENTLY ENTERTAINING and that there are a ton of books t...

    ((2.5 stars, rounded up for THAT plot twist)) hoo boy this is going to be a bitch of a review to write. i don't think i've ever been so conflicted about a book in a while. i'll start with the stuff i liked first. the plot and the concept was excellent. there have been no shorta...

    Who is this cover and where can I marry it???? ...

    This book was fantastic! At first, it seemed a bit cliched and stuff, but then it picked up and I couldn't put it down Genetics, coding, technology, big plot twists, fast paced, everything you could want in a sci-fi book Y you can tell the author researched it all and knew what ...

    I finished this book a while ago and totally forgot to write a review for it OOPS ITS FINE Basically, this book was beyond fun and sooOoOO interesting guys. It gave me slight The Darkest Minds vibes and I?m not really sure why it just did xD it?s like a sci-fi tech version of T...

    A great science fiction blend of post apocalyptic survival and genetic technology. It's like Warcross meets The Walking Dead. At times I thought this was just plain weird, and it is, but I enjoyed it. Content: Cannibalism. Plague/infection. Brutal descriptions of injury and self ...

    Actual rating 4.5 stars. I have read a slew of post-apocalyptic novels in which a deadly virus has wreaked havoc and culled the majority of our species. What ordinarily happens is that a portion of humanity devolves into zombie-like creatures, another into opportunistic gangs, and a...

    Checkout my full review + giveaway (ends 11/12) on my blog! http://omgbooksandmorebooks.blogspot.... THIS BOOK! In my opinion this should be required reading for science classes because the science level in this book is beyond from what I've seen in any YA book. It's amazing. The ca...

    this was much better than I expected (sorry for saying nothing else about this book but I currently have no power and shitty reception and an injured dog so that?s all for now) ...

    THIS REVIEW (AND MANY OTHERS) ARE ON MY BLOG Thank you Penguin Australia for sending me a review copy. All thoughts are my own. R A M B L E I went into this book with some low expectations. I?m not exactly sure why. I had requested it from Penguin a few months prior and had ...

    I received a copy of this book in exchange for an honest review. 3.5 stars. If your father was responsible for the apocalypse would you try to set it right? That's the dilemma Catarina faces when a mysterious man shows up at her cabin after a virus wiped out most of humanity, and...

    The earth is a desolate wasteland, a virus decimating humanity, survivors abandoned to starvation. Catarina Agatta is a survivor. Catarina is the seventeen year old daughter of the renowned geneticist Lachlan Agatta, a magnate and former Cartaxus programmer and genetic engineer, now re...

    Not bad at all. Was so into this book but there was so much underlying and bringing the girl Cole is missing up that you have a feeling what is coming when the big twist is revealed. As for some of the other characters, I honestly had a love hate with some, like Dax. However, this was ...

    4.5 stars Excellent. I loved the worldbuilding with all the built-in tech that people have for "genehacking". It was both brilliant and scary. The story was exciting and fast-paced, and I didn't see the ending coming. I'm absolutely in for the next book. ...

    Ahhhhh..... well this seems to be a polarizing kind of book. My GR feed: "This book is my favorite/coolest sci-fi of this year/all time" Also my GR feed: "This has flat characters and a love triangle and is very slow..." What to do? Try it I guess.... So I did and I dislike virus bo...

    4.5 stars Wow, this was a blast! (You know, because the Hydra virus makes you blow up and stuff? ... no? Screw you, that was funny.) This Mortal Coil was such an insane ride from start to finish. It was wild, it was gruesome, it was bloody and fantastic and bloody fantastic. You ...

    3.5 stars - I loved the plot - it did feel like your average dystopian, but the idea of the virus was so original and the plot twists and tech made it feel different - the twists and turns kept you wanting to read more and more - the tech was so so cool? I loved reading about tha...

    why do authors always ruin great premises with instalove and tropes ?? ...

    I did really enjoy this book and can't wait to pick up the next book. Something I did struggle with was getting into the story. There were times where I was 100% invested in the story but there were times where I wasn't. ...

    TCAGACATACGAGTAATGGATTACAGGTGCGAAGCTGTGGATGTAATAAGGCCATCACGACCGCTGGGACTCATCTATATAGCCATGCACGAGGCCAAGTATAATCCACCAGTCCCACAGACCTTAGCACCAGTTAAAGATAATTGGTACCAACCACCGGTGGCAAGATAGATTATTGCCTTCAAGCAACTCTCCATTAGTGCTACTTACGTCATCACGTGGGATCGTACGCTAGTTTACTAGTTTAATGAGTGGTTGCTGTACTGGCATGGTCGTCAACACGGTC...

    This Mortal Coil by Emily Suvada is a refreshing new dystopia/sci-fi/post-apocalyptic story that grabbed me from the start until the very end, and left me gaspingwith the many twists and turns. What immediately grabbed me from the start and impressed me was the writing style. Fr...

    There?s no gene for Run Like Hell? Or is there? Stop the presses I?ve found my new YA trilogy obsession with Emily Suvada?s ?This Mortal Coil? a fast paced, intricately woven, brilliantly fascinating and best of all intelligent and addictive thriller. Actually I?...

    BANG! Did that roller coaster just stop for a while? Woah! I wasn't prepared for such a fantastically written sci-fi thriller. This book got everything. To name a few, I experienced some razor sharp action, last minute escapes, a lot of seriously great plot twists, powerful dialogues...

    It's been a long time since a book has set my soul ablaze, leaving me anxious to devour its pages but wanting to savor every word. I loved this book with every ounce of my being: this is the epitome of why I love the science fiction genre all wrapped up into one. Fantastically written ...

    ?There?s no such thing as right anymore - that ended when the plague hit. Sometimes we need to do awful things to stop worse things from happening. You?re still thinking in terms of right and wrong, but this is war, and the rules have changed.? This was an interesting no...

    5 Out Of 5 "hacker-if-ic" STARS This book is amazing, one of the best dystopian's I've read in a while and absolutely a new favorite. For a book involving gene hacking, splicing, decoding and lots of technical terms and such this is completely comprehensible and seriously compelli...

  • Kaleena ★ Reader Voracious
    Nov 05, 2018

    Emily Suvada has written a brilliant dystopian science fiction thriller set in a future where humanity is threatened by a deadly plague that has people exploding into toxic Hydra clouds. Catarina Agatta is a talented hacker, 'bobcat', working with The Skies resistance movement against ...

    2 1/2 stars. This was? interesting, and also not my type of book, and kind of disappointing. I honestly think This Mortal Coil is bit of your typical plot-twisty-but-not-very-quality YA sci-fi , and although some things stood out, I just didn?t love it. The obvious upside of th...

    ?There?s no such thing quite as dangerous as an Agatta?s best intentions.? The beginning was intense and fast-paced but as it went on, the book really lost stream. Of course the length doesn?t help (420 pages) but it went off the rail for me when her martyrdom kicked in. I...

    3.5* A world where a disease has taken over and people have tech installed in their bodies. It's fast paced, action packed, heavy on romance, and decently entertaining. Cool and unique world. I want to make it clear that it's DECENTLY ENTERTAINING and that there are a ton of books t...

    ((2.5 stars, rounded up for THAT plot twist)) hoo boy this is going to be a bitch of a review to write. i don't think i've ever been so conflicted about a book in a while. i'll start with the stuff i liked first. the plot and the concept was excellent. there have been no shorta...

    Who is this cover and where can I marry it???? ...

    This book was fantastic! At first, it seemed a bit cliched and stuff, but then it picked up and I couldn't put it down Genetics, coding, technology, big plot twists, fast paced, everything you could want in a sci-fi book Y you can tell the author researched it all and knew what ...

    I finished this book a while ago and totally forgot to write a review for it OOPS ITS FINE Basically, this book was beyond fun and sooOoOO interesting guys. It gave me slight The Darkest Minds vibes and I?m not really sure why it just did xD it?s like a sci-fi tech version of T...

    A great science fiction blend of post apocalyptic survival and genetic technology. It's like Warcross meets The Walking Dead. At times I thought this was just plain weird, and it is, but I enjoyed it. Content: Cannibalism. Plague/infection. Brutal descriptions of injury and self ...

    Actual rating 4.5 stars. I have read a slew of post-apocalyptic novels in which a deadly virus has wreaked havoc and culled the majority of our species. What ordinarily happens is that a portion of humanity devolves into zombie-like creatures, another into opportunistic gangs, and a...

    Checkout my full review + giveaway (ends 11/12) on my blog! http://omgbooksandmorebooks.blogspot.... THIS BOOK! In my opinion this should be required reading for science classes because the science level in this book is beyond from what I've seen in any YA book. It's amazing. The ca...

    this was much better than I expected (sorry for saying nothing else about this book but I currently have no power and shitty reception and an injured dog so that?s all for now) ...

    THIS REVIEW (AND MANY OTHERS) ARE ON MY BLOG Thank you Penguin Australia for sending me a review copy. All thoughts are my own. R A M B L E I went into this book with some low expectations. I?m not exactly sure why. I had requested it from Penguin a few months prior and had ...

    I received a copy of this book in exchange for an honest review. 3.5 stars. If your father was responsible for the apocalypse would you try to set it right? That's the dilemma Catarina faces when a mysterious man shows up at her cabin after a virus wiped out most of humanity, and...

    The earth is a desolate wasteland, a virus decimating humanity, survivors abandoned to starvation. Catarina Agatta is a survivor. Catarina is the seventeen year old daughter of the renowned geneticist Lachlan Agatta, a magnate and former Cartaxus programmer and genetic engineer, now re...

    Not bad at all. Was so into this book but there was so much underlying and bringing the girl Cole is missing up that you have a feeling what is coming when the big twist is revealed. As for some of the other characters, I honestly had a love hate with some, like Dax. However, this was ...

    4.5 stars Excellent. I loved the worldbuilding with all the built-in tech that people have for "genehacking". It was both brilliant and scary. The story was exciting and fast-paced, and I didn't see the ending coming. I'm absolutely in for the next book. ...

    Ahhhhh..... well this seems to be a polarizing kind of book. My GR feed: "This book is my favorite/coolest sci-fi of this year/all time" Also my GR feed: "This has flat characters and a love triangle and is very slow..." What to do? Try it I guess.... So I did and I dislike virus bo...

    4.5 stars Wow, this was a blast! (You know, because the Hydra virus makes you blow up and stuff? ... no? Screw you, that was funny.) This Mortal Coil was such an insane ride from start to finish. It was wild, it was gruesome, it was bloody and fantastic and bloody fantastic. You ...

    3.5 stars - I loved the plot - it did feel like your average dystopian, but the idea of the virus was so original and the plot twists and tech made it feel different - the twists and turns kept you wanting to read more and more - the tech was so so cool? I loved reading about tha...

    why do authors always ruin great premises with instalove and tropes ?? ...

    I did really enjoy this book and can't wait to pick up the next book. Something I did struggle with was getting into the story. There were times where I was 100% invested in the story but there were times where I wasn't. ...

    TCAGACATACGAGTAATGGATTACAGGTGCGAAGCTGTGGATGTAATAAGGCCATCACGACCGCTGGGACTCATCTATATAGCCATGCACGAGGCCAAGTATAATCCACCAGTCCCACAGACCTTAGCACCAGTTAAAGATAATTGGTACCAACCACCGGTGGCAAGATAGATTATTGCCTTCAAGCAACTCTCCATTAGTGCTACTTACGTCATCACGTGGGATCGTACGCTAGTTTACTAGTTTAATGAGTGGTTGCTGTACTGGCATGGTCGTCAACACGGTC...

    This Mortal Coil by Emily Suvada is a refreshing new dystopia/sci-fi/post-apocalyptic story that grabbed me from the start until the very end, and left me gaspingwith the many twists and turns. What immediately grabbed me from the start and impressed me was the writing style. Fr...

    There?s no gene for Run Like Hell? Or is there? Stop the presses I?ve found my new YA trilogy obsession with Emily Suvada?s ?This Mortal Coil? a fast paced, intricately woven, brilliantly fascinating and best of all intelligent and addictive thriller. Actually I?...

    BANG! Did that roller coaster just stop for a while? Woah! I wasn't prepared for such a fantastically written sci-fi thriller. This book got everything. To name a few, I experienced some razor sharp action, last minute escapes, a lot of seriously great plot twists, powerful dialogues...

    It's been a long time since a book has set my soul ablaze, leaving me anxious to devour its pages but wanting to savor every word. I loved this book with every ounce of my being: this is the epitome of why I love the science fiction genre all wrapped up into one. Fantastically written ...

  • L A i N E Y
    Jul 09, 2018

    Emily Suvada has written a brilliant dystopian science fiction thriller set in a future where humanity is threatened by a deadly plague that has people exploding into toxic Hydra clouds. Catarina Agatta is a talented hacker, 'bobcat', working with The Skies resistance movement against ...

    2 1/2 stars. This was? interesting, and also not my type of book, and kind of disappointing. I honestly think This Mortal Coil is bit of your typical plot-twisty-but-not-very-quality YA sci-fi , and although some things stood out, I just didn?t love it. The obvious upside of th...

    ?There?s no such thing quite as dangerous as an Agatta?s best intentions.? The beginning was intense and fast-paced but as it went on, the book really lost stream. Of course the length doesn?t help (420 pages) but it went off the rail for me when her martyrdom kicked in. I...

  • Kelly (Diva Booknerd)
    Nov 11, 2017

    Emily Suvada has written a brilliant dystopian science fiction thriller set in a future where humanity is threatened by a deadly plague that has people exploding into toxic Hydra clouds. Catarina Agatta is a talented hacker, 'bobcat', working with The Skies resistance movement against ...

    2 1/2 stars. This was? interesting, and also not my type of book, and kind of disappointing. I honestly think This Mortal Coil is bit of your typical plot-twisty-but-not-very-quality YA sci-fi , and although some things stood out, I just didn?t love it. The obvious upside of th...

    ?There?s no such thing quite as dangerous as an Agatta?s best intentions.? The beginning was intense and fast-paced but as it went on, the book really lost stream. Of course the length doesn?t help (420 pages) but it went off the rail for me when her martyrdom kicked in. I...

    3.5* A world where a disease has taken over and people have tech installed in their bodies. It's fast paced, action packed, heavy on romance, and decently entertaining. Cool and unique world. I want to make it clear that it's DECENTLY ENTERTAINING and that there are a ton of books t...

    ((2.5 stars, rounded up for THAT plot twist)) hoo boy this is going to be a bitch of a review to write. i don't think i've ever been so conflicted about a book in a while. i'll start with the stuff i liked first. the plot and the concept was excellent. there have been no shorta...

    Who is this cover and where can I marry it???? ...

    This book was fantastic! At first, it seemed a bit cliched and stuff, but then it picked up and I couldn't put it down Genetics, coding, technology, big plot twists, fast paced, everything you could want in a sci-fi book Y you can tell the author researched it all and knew what ...

    I finished this book a while ago and totally forgot to write a review for it OOPS ITS FINE Basically, this book was beyond fun and sooOoOO interesting guys. It gave me slight The Darkest Minds vibes and I?m not really sure why it just did xD it?s like a sci-fi tech version of T...

    A great science fiction blend of post apocalyptic survival and genetic technology. It's like Warcross meets The Walking Dead. At times I thought this was just plain weird, and it is, but I enjoyed it. Content: Cannibalism. Plague/infection. Brutal descriptions of injury and self ...

    Actual rating 4.5 stars. I have read a slew of post-apocalyptic novels in which a deadly virus has wreaked havoc and culled the majority of our species. What ordinarily happens is that a portion of humanity devolves into zombie-like creatures, another into opportunistic gangs, and a...

    Checkout my full review + giveaway (ends 11/12) on my blog! http://omgbooksandmorebooks.blogspot.... THIS BOOK! In my opinion this should be required reading for science classes because the science level in this book is beyond from what I've seen in any YA book. It's amazing. The ca...

    this was much better than I expected (sorry for saying nothing else about this book but I currently have no power and shitty reception and an injured dog so that?s all for now) ...

    THIS REVIEW (AND MANY OTHERS) ARE ON MY BLOG Thank you Penguin Australia for sending me a review copy. All thoughts are my own. R A M B L E I went into this book with some low expectations. I?m not exactly sure why. I had requested it from Penguin a few months prior and had ...

    I received a copy of this book in exchange for an honest review. 3.5 stars. If your father was responsible for the apocalypse would you try to set it right? That's the dilemma Catarina faces when a mysterious man shows up at her cabin after a virus wiped out most of humanity, and...

    The earth is a desolate wasteland, a virus decimating humanity, survivors abandoned to starvation. Catarina Agatta is a survivor. Catarina is the seventeen year old daughter of the renowned geneticist Lachlan Agatta, a magnate and former Cartaxus programmer and genetic engineer, now re...

  • Lia
    Oct 11, 2017

    Emily Suvada has written a brilliant dystopian science fiction thriller set in a future where humanity is threatened by a deadly plague that has people exploding into toxic Hydra clouds. Catarina Agatta is a talented hacker, 'bobcat', working with The Skies resistance movement against ...

    2 1/2 stars. This was? interesting, and also not my type of book, and kind of disappointing. I honestly think This Mortal Coil is bit of your typical plot-twisty-but-not-very-quality YA sci-fi , and although some things stood out, I just didn?t love it. The obvious upside of th...

    ?There?s no such thing quite as dangerous as an Agatta?s best intentions.? The beginning was intense and fast-paced but as it went on, the book really lost stream. Of course the length doesn?t help (420 pages) but it went off the rail for me when her martyrdom kicked in. I...

    3.5* A world where a disease has taken over and people have tech installed in their bodies. It's fast paced, action packed, heavy on romance, and decently entertaining. Cool and unique world. I want to make it clear that it's DECENTLY ENTERTAINING and that there are a ton of books t...

    ((2.5 stars, rounded up for THAT plot twist)) hoo boy this is going to be a bitch of a review to write. i don't think i've ever been so conflicted about a book in a while. i'll start with the stuff i liked first. the plot and the concept was excellent. there have been no shorta...

    Who is this cover and where can I marry it???? ...

    This book was fantastic! At first, it seemed a bit cliched and stuff, but then it picked up and I couldn't put it down Genetics, coding, technology, big plot twists, fast paced, everything you could want in a sci-fi book Y you can tell the author researched it all and knew what ...

    I finished this book a while ago and totally forgot to write a review for it OOPS ITS FINE Basically, this book was beyond fun and sooOoOO interesting guys. It gave me slight The Darkest Minds vibes and I?m not really sure why it just did xD it?s like a sci-fi tech version of T...

    A great science fiction blend of post apocalyptic survival and genetic technology. It's like Warcross meets The Walking Dead. At times I thought this was just plain weird, and it is, but I enjoyed it. Content: Cannibalism. Plague/infection. Brutal descriptions of injury and self ...

    Actual rating 4.5 stars. I have read a slew of post-apocalyptic novels in which a deadly virus has wreaked havoc and culled the majority of our species. What ordinarily happens is that a portion of humanity devolves into zombie-like creatures, another into opportunistic gangs, and a...

    Checkout my full review + giveaway (ends 11/12) on my blog! http://omgbooksandmorebooks.blogspot.... THIS BOOK! In my opinion this should be required reading for science classes because the science level in this book is beyond from what I've seen in any YA book. It's amazing. The ca...

    this was much better than I expected (sorry for saying nothing else about this book but I currently have no power and shitty reception and an injured dog so that?s all for now) ...

    THIS REVIEW (AND MANY OTHERS) ARE ON MY BLOG Thank you Penguin Australia for sending me a review copy. All thoughts are my own. R A M B L E I went into this book with some low expectations. I?m not exactly sure why. I had requested it from Penguin a few months prior and had ...

    I received a copy of this book in exchange for an honest review. 3.5 stars. If your father was responsible for the apocalypse would you try to set it right? That's the dilemma Catarina faces when a mysterious man shows up at her cabin after a virus wiped out most of humanity, and...

    The earth is a desolate wasteland, a virus decimating humanity, survivors abandoned to starvation. Catarina Agatta is a survivor. Catarina is the seventeen year old daughter of the renowned geneticist Lachlan Agatta, a magnate and former Cartaxus programmer and genetic engineer, now re...

    Not bad at all. Was so into this book but there was so much underlying and bringing the girl Cole is missing up that you have a feeling what is coming when the big twist is revealed. As for some of the other characters, I honestly had a love hate with some, like Dax. However, this was ...

    4.5 stars Excellent. I loved the worldbuilding with all the built-in tech that people have for "genehacking". It was both brilliant and scary. The story was exciting and fast-paced, and I didn't see the ending coming. I'm absolutely in for the next book. ...

    Ahhhhh..... well this seems to be a polarizing kind of book. My GR feed: "This book is my favorite/coolest sci-fi of this year/all time" Also my GR feed: "This has flat characters and a love triangle and is very slow..." What to do? Try it I guess.... So I did and I dislike virus bo...

    4.5 stars Wow, this was a blast! (You know, because the Hydra virus makes you blow up and stuff? ... no? Screw you, that was funny.) This Mortal Coil was such an insane ride from start to finish. It was wild, it was gruesome, it was bloody and fantastic and bloody fantastic. You ...

    3.5 stars - I loved the plot - it did feel like your average dystopian, but the idea of the virus was so original and the plot twists and tech made it feel different - the twists and turns kept you wanting to read more and more - the tech was so so cool? I loved reading about tha...

    why do authors always ruin great premises with instalove and tropes ?? ...

    I did really enjoy this book and can't wait to pick up the next book. Something I did struggle with was getting into the story. There were times where I was 100% invested in the story but there were times where I wasn't. ...

    TCAGACATACGAGTAATGGATTACAGGTGCGAAGCTGTGGATGTAATAAGGCCATCACGACCGCTGGGACTCATCTATATAGCCATGCACGAGGCCAAGTATAATCCACCAGTCCCACAGACCTTAGCACCAGTTAAAGATAATTGGTACCAACCACCGGTGGCAAGATAGATTATTGCCTTCAAGCAACTCTCCATTAGTGCTACTTACGTCATCACGTGGGATCGTACGCTAGTTTACTAGTTTAATGAGTGGTTGCTGTACTGGCATGGTCGTCAACACGGTC...

    This Mortal Coil by Emily Suvada is a refreshing new dystopia/sci-fi/post-apocalyptic story that grabbed me from the start until the very end, and left me gaspingwith the many twists and turns. What immediately grabbed me from the start and impressed me was the writing style. Fr...

  • Liz Barnsley
    Sep 11, 2017

    Emily Suvada has written a brilliant dystopian science fiction thriller set in a future where humanity is threatened by a deadly plague that has people exploding into toxic Hydra clouds. Catarina Agatta is a talented hacker, 'bobcat', working with The Skies resistance movement against ...

    2 1/2 stars. This was? interesting, and also not my type of book, and kind of disappointing. I honestly think This Mortal Coil is bit of your typical plot-twisty-but-not-very-quality YA sci-fi , and although some things stood out, I just didn?t love it. The obvious upside of th...

    ?There?s no such thing quite as dangerous as an Agatta?s best intentions.? The beginning was intense and fast-paced but as it went on, the book really lost stream. Of course the length doesn?t help (420 pages) but it went off the rail for me when her martyrdom kicked in. I...

    3.5* A world where a disease has taken over and people have tech installed in their bodies. It's fast paced, action packed, heavy on romance, and decently entertaining. Cool and unique world. I want to make it clear that it's DECENTLY ENTERTAINING and that there are a ton of books t...

    ((2.5 stars, rounded up for THAT plot twist)) hoo boy this is going to be a bitch of a review to write. i don't think i've ever been so conflicted about a book in a while. i'll start with the stuff i liked first. the plot and the concept was excellent. there have been no shorta...

    Who is this cover and where can I marry it???? ...

    This book was fantastic! At first, it seemed a bit cliched and stuff, but then it picked up and I couldn't put it down Genetics, coding, technology, big plot twists, fast paced, everything you could want in a sci-fi book Y you can tell the author researched it all and knew what ...

    I finished this book a while ago and totally forgot to write a review for it OOPS ITS FINE Basically, this book was beyond fun and sooOoOO interesting guys. It gave me slight The Darkest Minds vibes and I?m not really sure why it just did xD it?s like a sci-fi tech version of T...

    A great science fiction blend of post apocalyptic survival and genetic technology. It's like Warcross meets The Walking Dead. At times I thought this was just plain weird, and it is, but I enjoyed it. Content: Cannibalism. Plague/infection. Brutal descriptions of injury and self ...

    Actual rating 4.5 stars. I have read a slew of post-apocalyptic novels in which a deadly virus has wreaked havoc and culled the majority of our species. What ordinarily happens is that a portion of humanity devolves into zombie-like creatures, another into opportunistic gangs, and a...

    Checkout my full review + giveaway (ends 11/12) on my blog! http://omgbooksandmorebooks.blogspot.... THIS BOOK! In my opinion this should be required reading for science classes because the science level in this book is beyond from what I've seen in any YA book. It's amazing. The ca...

    this was much better than I expected (sorry for saying nothing else about this book but I currently have no power and shitty reception and an injured dog so that?s all for now) ...

    THIS REVIEW (AND MANY OTHERS) ARE ON MY BLOG Thank you Penguin Australia for sending me a review copy. All thoughts are my own. R A M B L E I went into this book with some low expectations. I?m not exactly sure why. I had requested it from Penguin a few months prior and had ...

    I received a copy of this book in exchange for an honest review. 3.5 stars. If your father was responsible for the apocalypse would you try to set it right? That's the dilemma Catarina faces when a mysterious man shows up at her cabin after a virus wiped out most of humanity, and...

    The earth is a desolate wasteland, a virus decimating humanity, survivors abandoned to starvation. Catarina Agatta is a survivor. Catarina is the seventeen year old daughter of the renowned geneticist Lachlan Agatta, a magnate and former Cartaxus programmer and genetic engineer, now re...

    Not bad at all. Was so into this book but there was so much underlying and bringing the girl Cole is missing up that you have a feeling what is coming when the big twist is revealed. As for some of the other characters, I honestly had a love hate with some, like Dax. However, this was ...

    4.5 stars Excellent. I loved the worldbuilding with all the built-in tech that people have for "genehacking". It was both brilliant and scary. The story was exciting and fast-paced, and I didn't see the ending coming. I'm absolutely in for the next book. ...

    Ahhhhh..... well this seems to be a polarizing kind of book. My GR feed: "This book is my favorite/coolest sci-fi of this year/all time" Also my GR feed: "This has flat characters and a love triangle and is very slow..." What to do? Try it I guess.... So I did and I dislike virus bo...

    4.5 stars Wow, this was a blast! (You know, because the Hydra virus makes you blow up and stuff? ... no? Screw you, that was funny.) This Mortal Coil was such an insane ride from start to finish. It was wild, it was gruesome, it was bloody and fantastic and bloody fantastic. You ...

    3.5 stars - I loved the plot - it did feel like your average dystopian, but the idea of the virus was so original and the plot twists and tech made it feel different - the twists and turns kept you wanting to read more and more - the tech was so so cool? I loved reading about tha...

    why do authors always ruin great premises with instalove and tropes ?? ...

    I did really enjoy this book and can't wait to pick up the next book. Something I did struggle with was getting into the story. There were times where I was 100% invested in the story but there were times where I wasn't. ...

    TCAGACATACGAGTAATGGATTACAGGTGCGAAGCTGTGGATGTAATAAGGCCATCACGACCGCTGGGACTCATCTATATAGCCATGCACGAGGCCAAGTATAATCCACCAGTCCCACAGACCTTAGCACCAGTTAAAGATAATTGGTACCAACCACCGGTGGCAAGATAGATTATTGCCTTCAAGCAACTCTCCATTAGTGCTACTTACGTCATCACGTGGGATCGTACGCTAGTTTACTAGTTTAATGAGTGGTTGCTGTACTGGCATGGTCGTCAACACGGTC...

    This Mortal Coil by Emily Suvada is a refreshing new dystopia/sci-fi/post-apocalyptic story that grabbed me from the start until the very end, and left me gaspingwith the many twists and turns. What immediately grabbed me from the start and impressed me was the writing style. Fr...

    There?s no gene for Run Like Hell? Or is there? Stop the presses I?ve found my new YA trilogy obsession with Emily Suvada?s ?This Mortal Coil? a fast paced, intricately woven, brilliantly fascinating and best of all intelligent and addictive thriller. Actually I?...

  • rachel
    Nov 06, 2017

    Emily Suvada has written a brilliant dystopian science fiction thriller set in a future where humanity is threatened by a deadly plague that has people exploding into toxic Hydra clouds. Catarina Agatta is a talented hacker, 'bobcat', working with The Skies resistance movement against ...

    2 1/2 stars. This was? interesting, and also not my type of book, and kind of disappointing. I honestly think This Mortal Coil is bit of your typical plot-twisty-but-not-very-quality YA sci-fi , and although some things stood out, I just didn?t love it. The obvious upside of th...

    ?There?s no such thing quite as dangerous as an Agatta?s best intentions.? The beginning was intense and fast-paced but as it went on, the book really lost stream. Of course the length doesn?t help (420 pages) but it went off the rail for me when her martyrdom kicked in. I...

    3.5* A world where a disease has taken over and people have tech installed in their bodies. It's fast paced, action packed, heavy on romance, and decently entertaining. Cool and unique world. I want to make it clear that it's DECENTLY ENTERTAINING and that there are a ton of books t...

    ((2.5 stars, rounded up for THAT plot twist)) hoo boy this is going to be a bitch of a review to write. i don't think i've ever been so conflicted about a book in a while. i'll start with the stuff i liked first. the plot and the concept was excellent. there have been no shorta...

    Who is this cover and where can I marry it???? ...

    This book was fantastic! At first, it seemed a bit cliched and stuff, but then it picked up and I couldn't put it down Genetics, coding, technology, big plot twists, fast paced, everything you could want in a sci-fi book Y you can tell the author researched it all and knew what ...

    I finished this book a while ago and totally forgot to write a review for it OOPS ITS FINE Basically, this book was beyond fun and sooOoOO interesting guys. It gave me slight The Darkest Minds vibes and I?m not really sure why it just did xD it?s like a sci-fi tech version of T...

    A great science fiction blend of post apocalyptic survival and genetic technology. It's like Warcross meets The Walking Dead. At times I thought this was just plain weird, and it is, but I enjoyed it. Content: Cannibalism. Plague/infection. Brutal descriptions of injury and self ...

    Actual rating 4.5 stars. I have read a slew of post-apocalyptic novels in which a deadly virus has wreaked havoc and culled the majority of our species. What ordinarily happens is that a portion of humanity devolves into zombie-like creatures, another into opportunistic gangs, and a...

    Checkout my full review + giveaway (ends 11/12) on my blog! http://omgbooksandmorebooks.blogspot.... THIS BOOK! In my opinion this should be required reading for science classes because the science level in this book is beyond from what I've seen in any YA book. It's amazing. The ca...

    this was much better than I expected (sorry for saying nothing else about this book but I currently have no power and shitty reception and an injured dog so that?s all for now) ...

    THIS REVIEW (AND MANY OTHERS) ARE ON MY BLOG Thank you Penguin Australia for sending me a review copy. All thoughts are my own. R A M B L E I went into this book with some low expectations. I?m not exactly sure why. I had requested it from Penguin a few months prior and had ...

    I received a copy of this book in exchange for an honest review. 3.5 stars. If your father was responsible for the apocalypse would you try to set it right? That's the dilemma Catarina faces when a mysterious man shows up at her cabin after a virus wiped out most of humanity, and...

    The earth is a desolate wasteland, a virus decimating humanity, survivors abandoned to starvation. Catarina Agatta is a survivor. Catarina is the seventeen year old daughter of the renowned geneticist Lachlan Agatta, a magnate and former Cartaxus programmer and genetic engineer, now re...

    Not bad at all. Was so into this book but there was so much underlying and bringing the girl Cole is missing up that you have a feeling what is coming when the big twist is revealed. As for some of the other characters, I honestly had a love hate with some, like Dax. However, this was ...

    4.5 stars Excellent. I loved the worldbuilding with all the built-in tech that people have for "genehacking". It was both brilliant and scary. The story was exciting and fast-paced, and I didn't see the ending coming. I'm absolutely in for the next book. ...

    Ahhhhh..... well this seems to be a polarizing kind of book. My GR feed: "This book is my favorite/coolest sci-fi of this year/all time" Also my GR feed: "This has flat characters and a love triangle and is very slow..." What to do? Try it I guess.... So I did and I dislike virus bo...

    4.5 stars Wow, this was a blast! (You know, because the Hydra virus makes you blow up and stuff? ... no? Screw you, that was funny.) This Mortal Coil was such an insane ride from start to finish. It was wild, it was gruesome, it was bloody and fantastic and bloody fantastic. You ...

    3.5 stars - I loved the plot - it did feel like your average dystopian, but the idea of the virus was so original and the plot twists and tech made it feel different - the twists and turns kept you wanting to read more and more - the tech was so so cool? I loved reading about tha...

    why do authors always ruin great premises with instalove and tropes ?? ...

  • Justine
    Oct 25, 2017

    Emily Suvada has written a brilliant dystopian science fiction thriller set in a future where humanity is threatened by a deadly plague that has people exploding into toxic Hydra clouds. Catarina Agatta is a talented hacker, 'bobcat', working with The Skies resistance movement against ...

    2 1/2 stars. This was? interesting, and also not my type of book, and kind of disappointing. I honestly think This Mortal Coil is bit of your typical plot-twisty-but-not-very-quality YA sci-fi , and although some things stood out, I just didn?t love it. The obvious upside of th...

    ?There?s no such thing quite as dangerous as an Agatta?s best intentions.? The beginning was intense and fast-paced but as it went on, the book really lost stream. Of course the length doesn?t help (420 pages) but it went off the rail for me when her martyrdom kicked in. I...

    3.5* A world where a disease has taken over and people have tech installed in their bodies. It's fast paced, action packed, heavy on romance, and decently entertaining. Cool and unique world. I want to make it clear that it's DECENTLY ENTERTAINING and that there are a ton of books t...

    ((2.5 stars, rounded up for THAT plot twist)) hoo boy this is going to be a bitch of a review to write. i don't think i've ever been so conflicted about a book in a while. i'll start with the stuff i liked first. the plot and the concept was excellent. there have been no shorta...

    Who is this cover and where can I marry it???? ...

    This book was fantastic! At first, it seemed a bit cliched and stuff, but then it picked up and I couldn't put it down Genetics, coding, technology, big plot twists, fast paced, everything you could want in a sci-fi book Y you can tell the author researched it all and knew what ...

    I finished this book a while ago and totally forgot to write a review for it OOPS ITS FINE Basically, this book was beyond fun and sooOoOO interesting guys. It gave me slight The Darkest Minds vibes and I?m not really sure why it just did xD it?s like a sci-fi tech version of T...

    A great science fiction blend of post apocalyptic survival and genetic technology. It's like Warcross meets The Walking Dead. At times I thought this was just plain weird, and it is, but I enjoyed it. Content: Cannibalism. Plague/infection. Brutal descriptions of injury and self ...

    Actual rating 4.5 stars. I have read a slew of post-apocalyptic novels in which a deadly virus has wreaked havoc and culled the majority of our species. What ordinarily happens is that a portion of humanity devolves into zombie-like creatures, another into opportunistic gangs, and a...

    Checkout my full review + giveaway (ends 11/12) on my blog! http://omgbooksandmorebooks.blogspot.... THIS BOOK! In my opinion this should be required reading for science classes because the science level in this book is beyond from what I've seen in any YA book. It's amazing. The ca...

    this was much better than I expected (sorry for saying nothing else about this book but I currently have no power and shitty reception and an injured dog so that?s all for now) ...

    THIS REVIEW (AND MANY OTHERS) ARE ON MY BLOG Thank you Penguin Australia for sending me a review copy. All thoughts are my own. R A M B L E I went into this book with some low expectations. I?m not exactly sure why. I had requested it from Penguin a few months prior and had ...

    I received a copy of this book in exchange for an honest review. 3.5 stars. If your father was responsible for the apocalypse would you try to set it right? That's the dilemma Catarina faces when a mysterious man shows up at her cabin after a virus wiped out most of humanity, and...

    The earth is a desolate wasteland, a virus decimating humanity, survivors abandoned to starvation. Catarina Agatta is a survivor. Catarina is the seventeen year old daughter of the renowned geneticist Lachlan Agatta, a magnate and former Cartaxus programmer and genetic engineer, now re...

    Not bad at all. Was so into this book but there was so much underlying and bringing the girl Cole is missing up that you have a feeling what is coming when the big twist is revealed. As for some of the other characters, I honestly had a love hate with some, like Dax. However, this was ...

    4.5 stars Excellent. I loved the worldbuilding with all the built-in tech that people have for "genehacking". It was both brilliant and scary. The story was exciting and fast-paced, and I didn't see the ending coming. I'm absolutely in for the next book. ...

  • ☙ percy ❧
    Jun 22, 2017

    Emily Suvada has written a brilliant dystopian science fiction thriller set in a future where humanity is threatened by a deadly plague that has people exploding into toxic Hydra clouds. Catarina Agatta is a talented hacker, 'bobcat', working with The Skies resistance movement against ...

    2 1/2 stars. This was? interesting, and also not my type of book, and kind of disappointing. I honestly think This Mortal Coil is bit of your typical plot-twisty-but-not-very-quality YA sci-fi , and although some things stood out, I just didn?t love it. The obvious upside of th...

    ?There?s no such thing quite as dangerous as an Agatta?s best intentions.? The beginning was intense and fast-paced but as it went on, the book really lost stream. Of course the length doesn?t help (420 pages) but it went off the rail for me when her martyrdom kicked in. I...

    3.5* A world where a disease has taken over and people have tech installed in their bodies. It's fast paced, action packed, heavy on romance, and decently entertaining. Cool and unique world. I want to make it clear that it's DECENTLY ENTERTAINING and that there are a ton of books t...

    ((2.5 stars, rounded up for THAT plot twist)) hoo boy this is going to be a bitch of a review to write. i don't think i've ever been so conflicted about a book in a while. i'll start with the stuff i liked first. the plot and the concept was excellent. there have been no shorta...

  • Amelia
    Sep 24, 2018

    Emily Suvada has written a brilliant dystopian science fiction thriller set in a future where humanity is threatened by a deadly plague that has people exploding into toxic Hydra clouds. Catarina Agatta is a talented hacker, 'bobcat', working with The Skies resistance movement against ...

    2 1/2 stars. This was? interesting, and also not my type of book, and kind of disappointing. I honestly think This Mortal Coil is bit of your typical plot-twisty-but-not-very-quality YA sci-fi , and although some things stood out, I just didn?t love it. The obvious upside of th...

    ?There?s no such thing quite as dangerous as an Agatta?s best intentions.? The beginning was intense and fast-paced but as it went on, the book really lost stream. Of course the length doesn?t help (420 pages) but it went off the rail for me when her martyrdom kicked in. I...

    3.5* A world where a disease has taken over and people have tech installed in their bodies. It's fast paced, action packed, heavy on romance, and decently entertaining. Cool and unique world. I want to make it clear that it's DECENTLY ENTERTAINING and that there are a ton of books t...

    ((2.5 stars, rounded up for THAT plot twist)) hoo boy this is going to be a bitch of a review to write. i don't think i've ever been so conflicted about a book in a while. i'll start with the stuff i liked first. the plot and the concept was excellent. there have been no shorta...

    Who is this cover and where can I marry it???? ...

    This book was fantastic! At first, it seemed a bit cliched and stuff, but then it picked up and I couldn't put it down Genetics, coding, technology, big plot twists, fast paced, everything you could want in a sci-fi book Y you can tell the author researched it all and knew what ...

    I finished this book a while ago and totally forgot to write a review for it OOPS ITS FINE Basically, this book was beyond fun and sooOoOO interesting guys. It gave me slight The Darkest Minds vibes and I?m not really sure why it just did xD it?s like a sci-fi tech version of T...

    A great science fiction blend of post apocalyptic survival and genetic technology. It's like Warcross meets The Walking Dead. At times I thought this was just plain weird, and it is, but I enjoyed it. Content: Cannibalism. Plague/infection. Brutal descriptions of injury and self ...

    Actual rating 4.5 stars. I have read a slew of post-apocalyptic novels in which a deadly virus has wreaked havoc and culled the majority of our species. What ordinarily happens is that a portion of humanity devolves into zombie-like creatures, another into opportunistic gangs, and a...

    Checkout my full review + giveaway (ends 11/12) on my blog! http://omgbooksandmorebooks.blogspot.... THIS BOOK! In my opinion this should be required reading for science classes because the science level in this book is beyond from what I've seen in any YA book. It's amazing. The ca...

    this was much better than I expected (sorry for saying nothing else about this book but I currently have no power and shitty reception and an injured dog so that?s all for now) ...

    THIS REVIEW (AND MANY OTHERS) ARE ON MY BLOG Thank you Penguin Australia for sending me a review copy. All thoughts are my own. R A M B L E I went into this book with some low expectations. I?m not exactly sure why. I had requested it from Penguin a few months prior and had ...

    I received a copy of this book in exchange for an honest review. 3.5 stars. If your father was responsible for the apocalypse would you try to set it right? That's the dilemma Catarina faces when a mysterious man shows up at her cabin after a virus wiped out most of humanity, and...

    The earth is a desolate wasteland, a virus decimating humanity, survivors abandoned to starvation. Catarina Agatta is a survivor. Catarina is the seventeen year old daughter of the renowned geneticist Lachlan Agatta, a magnate and former Cartaxus programmer and genetic engineer, now re...

    Not bad at all. Was so into this book but there was so much underlying and bringing the girl Cole is missing up that you have a feeling what is coming when the big twist is revealed. As for some of the other characters, I honestly had a love hate with some, like Dax. However, this was ...

    4.5 stars Excellent. I loved the worldbuilding with all the built-in tech that people have for "genehacking". It was both brilliant and scary. The story was exciting and fast-paced, and I didn't see the ending coming. I'm absolutely in for the next book. ...

    Ahhhhh..... well this seems to be a polarizing kind of book. My GR feed: "This book is my favorite/coolest sci-fi of this year/all time" Also my GR feed: "This has flat characters and a love triangle and is very slow..." What to do? Try it I guess.... So I did and I dislike virus bo...

    4.5 stars Wow, this was a blast! (You know, because the Hydra virus makes you blow up and stuff? ... no? Screw you, that was funny.) This Mortal Coil was such an insane ride from start to finish. It was wild, it was gruesome, it was bloody and fantastic and bloody fantastic. You ...

    3.5 stars - I loved the plot - it did feel like your average dystopian, but the idea of the virus was so original and the plot twists and tech made it feel different - the twists and turns kept you wanting to read more and more - the tech was so so cool? I loved reading about tha...

    why do authors always ruin great premises with instalove and tropes ?? ...

    I did really enjoy this book and can't wait to pick up the next book. Something I did struggle with was getting into the story. There were times where I was 100% invested in the story but there were times where I wasn't. ...

  • Emily Suvada
    Jun 12, 2018

    Emily Suvada has written a brilliant dystopian science fiction thriller set in a future where humanity is threatened by a deadly plague that has people exploding into toxic Hydra clouds. Catarina Agatta is a talented hacker, 'bobcat', working with The Skies resistance movement against ...

    2 1/2 stars. This was? interesting, and also not my type of book, and kind of disappointing. I honestly think This Mortal Coil is bit of your typical plot-twisty-but-not-very-quality YA sci-fi , and although some things stood out, I just didn?t love it. The obvious upside of th...

    ?There?s no such thing quite as dangerous as an Agatta?s best intentions.? The beginning was intense and fast-paced but as it went on, the book really lost stream. Of course the length doesn?t help (420 pages) but it went off the rail for me when her martyrdom kicked in. I...

    3.5* A world where a disease has taken over and people have tech installed in their bodies. It's fast paced, action packed, heavy on romance, and decently entertaining. Cool and unique world. I want to make it clear that it's DECENTLY ENTERTAINING and that there are a ton of books t...

    ((2.5 stars, rounded up for THAT plot twist)) hoo boy this is going to be a bitch of a review to write. i don't think i've ever been so conflicted about a book in a while. i'll start with the stuff i liked first. the plot and the concept was excellent. there have been no shorta...

    Who is this cover and where can I marry it???? ...

    This book was fantastic! At first, it seemed a bit cliched and stuff, but then it picked up and I couldn't put it down Genetics, coding, technology, big plot twists, fast paced, everything you could want in a sci-fi book Y you can tell the author researched it all and knew what ...

    I finished this book a while ago and totally forgot to write a review for it OOPS ITS FINE Basically, this book was beyond fun and sooOoOO interesting guys. It gave me slight The Darkest Minds vibes and I?m not really sure why it just did xD it?s like a sci-fi tech version of T...

    A great science fiction blend of post apocalyptic survival and genetic technology. It's like Warcross meets The Walking Dead. At times I thought this was just plain weird, and it is, but I enjoyed it. Content: Cannibalism. Plague/infection. Brutal descriptions of injury and self ...

    Actual rating 4.5 stars. I have read a slew of post-apocalyptic novels in which a deadly virus has wreaked havoc and culled the majority of our species. What ordinarily happens is that a portion of humanity devolves into zombie-like creatures, another into opportunistic gangs, and a...

    Checkout my full review + giveaway (ends 11/12) on my blog! http://omgbooksandmorebooks.blogspot.... THIS BOOK! In my opinion this should be required reading for science classes because the science level in this book is beyond from what I've seen in any YA book. It's amazing. The ca...

    this was much better than I expected (sorry for saying nothing else about this book but I currently have no power and shitty reception and an injured dog so that?s all for now) ...

    THIS REVIEW (AND MANY OTHERS) ARE ON MY BLOG Thank you Penguin Australia for sending me a review copy. All thoughts are my own. R A M B L E I went into this book with some low expectations. I?m not exactly sure why. I had requested it from Penguin a few months prior and had ...

    I received a copy of this book in exchange for an honest review. 3.5 stars. If your father was responsible for the apocalypse would you try to set it right? That's the dilemma Catarina faces when a mysterious man shows up at her cabin after a virus wiped out most of humanity, and...

    The earth is a desolate wasteland, a virus decimating humanity, survivors abandoned to starvation. Catarina Agatta is a survivor. Catarina is the seventeen year old daughter of the renowned geneticist Lachlan Agatta, a magnate and former Cartaxus programmer and genetic engineer, now re...

    Not bad at all. Was so into this book but there was so much underlying and bringing the girl Cole is missing up that you have a feeling what is coming when the big twist is revealed. As for some of the other characters, I honestly had a love hate with some, like Dax. However, this was ...

    4.5 stars Excellent. I loved the worldbuilding with all the built-in tech that people have for "genehacking". It was both brilliant and scary. The story was exciting and fast-paced, and I didn't see the ending coming. I'm absolutely in for the next book. ...

    Ahhhhh..... well this seems to be a polarizing kind of book. My GR feed: "This book is my favorite/coolest sci-fi of this year/all time" Also my GR feed: "This has flat characters and a love triangle and is very slow..." What to do? Try it I guess.... So I did and I dislike virus bo...

    4.5 stars Wow, this was a blast! (You know, because the Hydra virus makes you blow up and stuff? ... no? Screw you, that was funny.) This Mortal Coil was such an insane ride from start to finish. It was wild, it was gruesome, it was bloody and fantastic and bloody fantastic. You ...

    3.5 stars - I loved the plot - it did feel like your average dystopian, but the idea of the virus was so original and the plot twists and tech made it feel different - the twists and turns kept you wanting to read more and more - the tech was so so cool? I loved reading about tha...

    why do authors always ruin great premises with instalove and tropes ?? ...

    I did really enjoy this book and can't wait to pick up the next book. Something I did struggle with was getting into the story. There were times where I was 100% invested in the story but there were times where I wasn't. ...

    TCAGACATACGAGTAATGGATTACAGGTGCGAAGCTGTGGATGTAATAAGGCCATCACGACCGCTGGGACTCATCTATATAGCCATGCACGAGGCCAAGTATAATCCACCAGTCCCACAGACCTTAGCACCAGTTAAAGATAATTGGTACCAACCACCGGTGGCAAGATAGATTATTGCCTTCAAGCAACTCTCCATTAGTGCTACTTACGTCATCACGTGGGATCGTACGCTAGTTTACTAGTTTAATGAGTGGTTGCTGTACTGGCATGGTCGTCAACACGGTC...

  • ambsreads
    Oct 30, 2017

    Emily Suvada has written a brilliant dystopian science fiction thriller set in a future where humanity is threatened by a deadly plague that has people exploding into toxic Hydra clouds. Catarina Agatta is a talented hacker, 'bobcat', working with The Skies resistance movement against ...

    2 1/2 stars. This was? interesting, and also not my type of book, and kind of disappointing. I honestly think This Mortal Coil is bit of your typical plot-twisty-but-not-very-quality YA sci-fi , and although some things stood out, I just didn?t love it. The obvious upside of th...

    ?There?s no such thing quite as dangerous as an Agatta?s best intentions.? The beginning was intense and fast-paced but as it went on, the book really lost stream. Of course the length doesn?t help (420 pages) but it went off the rail for me when her martyrdom kicked in. I...

    3.5* A world where a disease has taken over and people have tech installed in their bodies. It's fast paced, action packed, heavy on romance, and decently entertaining. Cool and unique world. I want to make it clear that it's DECENTLY ENTERTAINING and that there are a ton of books t...

    ((2.5 stars, rounded up for THAT plot twist)) hoo boy this is going to be a bitch of a review to write. i don't think i've ever been so conflicted about a book in a while. i'll start with the stuff i liked first. the plot and the concept was excellent. there have been no shorta...

    Who is this cover and where can I marry it???? ...

    This book was fantastic! At first, it seemed a bit cliched and stuff, but then it picked up and I couldn't put it down Genetics, coding, technology, big plot twists, fast paced, everything you could want in a sci-fi book Y you can tell the author researched it all and knew what ...

    I finished this book a while ago and totally forgot to write a review for it OOPS ITS FINE Basically, this book was beyond fun and sooOoOO interesting guys. It gave me slight The Darkest Minds vibes and I?m not really sure why it just did xD it?s like a sci-fi tech version of T...

    A great science fiction blend of post apocalyptic survival and genetic technology. It's like Warcross meets The Walking Dead. At times I thought this was just plain weird, and it is, but I enjoyed it. Content: Cannibalism. Plague/infection. Brutal descriptions of injury and self ...

    Actual rating 4.5 stars. I have read a slew of post-apocalyptic novels in which a deadly virus has wreaked havoc and culled the majority of our species. What ordinarily happens is that a portion of humanity devolves into zombie-like creatures, another into opportunistic gangs, and a...

    Checkout my full review + giveaway (ends 11/12) on my blog! http://omgbooksandmorebooks.blogspot.... THIS BOOK! In my opinion this should be required reading for science classes because the science level in this book is beyond from what I've seen in any YA book. It's amazing. The ca...

    this was much better than I expected (sorry for saying nothing else about this book but I currently have no power and shitty reception and an injured dog so that?s all for now) ...

    THIS REVIEW (AND MANY OTHERS) ARE ON MY BLOG Thank you Penguin Australia for sending me a review copy. All thoughts are my own. R A M B L E I went into this book with some low expectations. I?m not exactly sure why. I had requested it from Penguin a few months prior and had ...

  • emi
    Jul 04, 2017

    Emily Suvada has written a brilliant dystopian science fiction thriller set in a future where humanity is threatened by a deadly plague that has people exploding into toxic Hydra clouds. Catarina Agatta is a talented hacker, 'bobcat', working with The Skies resistance movement against ...

    2 1/2 stars. This was? interesting, and also not my type of book, and kind of disappointing. I honestly think This Mortal Coil is bit of your typical plot-twisty-but-not-very-quality YA sci-fi , and although some things stood out, I just didn?t love it. The obvious upside of th...

    ?There?s no such thing quite as dangerous as an Agatta?s best intentions.? The beginning was intense and fast-paced but as it went on, the book really lost stream. Of course the length doesn?t help (420 pages) but it went off the rail for me when her martyrdom kicked in. I...

    3.5* A world where a disease has taken over and people have tech installed in their bodies. It's fast paced, action packed, heavy on romance, and decently entertaining. Cool and unique world. I want to make it clear that it's DECENTLY ENTERTAINING and that there are a ton of books t...

    ((2.5 stars, rounded up for THAT plot twist)) hoo boy this is going to be a bitch of a review to write. i don't think i've ever been so conflicted about a book in a while. i'll start with the stuff i liked first. the plot and the concept was excellent. there have been no shorta...

    Who is this cover and where can I marry it???? ...

  • Jill
    Oct 28, 2017

    Emily Suvada has written a brilliant dystopian science fiction thriller set in a future where humanity is threatened by a deadly plague that has people exploding into toxic Hydra clouds. Catarina Agatta is a talented hacker, 'bobcat', working with The Skies resistance movement against ...

    2 1/2 stars. This was? interesting, and also not my type of book, and kind of disappointing. I honestly think This Mortal Coil is bit of your typical plot-twisty-but-not-very-quality YA sci-fi , and although some things stood out, I just didn?t love it. The obvious upside of th...

    ?There?s no such thing quite as dangerous as an Agatta?s best intentions.? The beginning was intense and fast-paced but as it went on, the book really lost stream. Of course the length doesn?t help (420 pages) but it went off the rail for me when her martyrdom kicked in. I...

    3.5* A world where a disease has taken over and people have tech installed in their bodies. It's fast paced, action packed, heavy on romance, and decently entertaining. Cool and unique world. I want to make it clear that it's DECENTLY ENTERTAINING and that there are a ton of books t...

    ((2.5 stars, rounded up for THAT plot twist)) hoo boy this is going to be a bitch of a review to write. i don't think i've ever been so conflicted about a book in a while. i'll start with the stuff i liked first. the plot and the concept was excellent. there have been no shorta...

    Who is this cover and where can I marry it???? ...

    This book was fantastic! At first, it seemed a bit cliched and stuff, but then it picked up and I couldn't put it down Genetics, coding, technology, big plot twists, fast paced, everything you could want in a sci-fi book Y you can tell the author researched it all and knew what ...

    I finished this book a while ago and totally forgot to write a review for it OOPS ITS FINE Basically, this book was beyond fun and sooOoOO interesting guys. It gave me slight The Darkest Minds vibes and I?m not really sure why it just did xD it?s like a sci-fi tech version of T...

  • Paromjit
    Sep 14, 2017

    Emily Suvada has written a brilliant dystopian science fiction thriller set in a future where humanity is threatened by a deadly plague that has people exploding into toxic Hydra clouds. Catarina Agatta is a talented hacker, 'bobcat', working with The Skies resistance movement against ...

  • Abbie (boneseasonofglass)
    Nov 25, 2017

    Emily Suvada has written a brilliant dystopian science fiction thriller set in a future where humanity is threatened by a deadly plague that has people exploding into toxic Hydra clouds. Catarina Agatta is a talented hacker, 'bobcat', working with The Skies resistance movement against ...

    2 1/2 stars. This was? interesting, and also not my type of book, and kind of disappointing. I honestly think This Mortal Coil is bit of your typical plot-twisty-but-not-very-quality YA sci-fi , and although some things stood out, I just didn?t love it. The obvious upside of th...

    ?There?s no such thing quite as dangerous as an Agatta?s best intentions.? The beginning was intense and fast-paced but as it went on, the book really lost stream. Of course the length doesn?t help (420 pages) but it went off the rail for me when her martyrdom kicked in. I...

    3.5* A world where a disease has taken over and people have tech installed in their bodies. It's fast paced, action packed, heavy on romance, and decently entertaining. Cool and unique world. I want to make it clear that it's DECENTLY ENTERTAINING and that there are a ton of books t...

    ((2.5 stars, rounded up for THAT plot twist)) hoo boy this is going to be a bitch of a review to write. i don't think i've ever been so conflicted about a book in a while. i'll start with the stuff i liked first. the plot and the concept was excellent. there have been no shorta...

    Who is this cover and where can I marry it???? ...

    This book was fantastic! At first, it seemed a bit cliched and stuff, but then it picked up and I couldn't put it down Genetics, coding, technology, big plot twists, fast paced, everything you could want in a sci-fi book Y you can tell the author researched it all and knew what ...

  • Sabrina
    Sep 04, 2017

    Emily Suvada has written a brilliant dystopian science fiction thriller set in a future where humanity is threatened by a deadly plague that has people exploding into toxic Hydra clouds. Catarina Agatta is a talented hacker, 'bobcat', working with The Skies resistance movement against ...

    2 1/2 stars. This was? interesting, and also not my type of book, and kind of disappointing. I honestly think This Mortal Coil is bit of your typical plot-twisty-but-not-very-quality YA sci-fi , and although some things stood out, I just didn?t love it. The obvious upside of th...

    ?There?s no such thing quite as dangerous as an Agatta?s best intentions.? The beginning was intense and fast-paced but as it went on, the book really lost stream. Of course the length doesn?t help (420 pages) but it went off the rail for me when her martyrdom kicked in. I...

    3.5* A world where a disease has taken over and people have tech installed in their bodies. It's fast paced, action packed, heavy on romance, and decently entertaining. Cool and unique world. I want to make it clear that it's DECENTLY ENTERTAINING and that there are a ton of books t...

    ((2.5 stars, rounded up for THAT plot twist)) hoo boy this is going to be a bitch of a review to write. i don't think i've ever been so conflicted about a book in a while. i'll start with the stuff i liked first. the plot and the concept was excellent. there have been no shorta...

    Who is this cover and where can I marry it???? ...

    This book was fantastic! At first, it seemed a bit cliched and stuff, but then it picked up and I couldn't put it down Genetics, coding, technology, big plot twists, fast paced, everything you could want in a sci-fi book Y you can tell the author researched it all and knew what ...

    I finished this book a while ago and totally forgot to write a review for it OOPS ITS FINE Basically, this book was beyond fun and sooOoOO interesting guys. It gave me slight The Darkest Minds vibes and I?m not really sure why it just did xD it?s like a sci-fi tech version of T...

    A great science fiction blend of post apocalyptic survival and genetic technology. It's like Warcross meets The Walking Dead. At times I thought this was just plain weird, and it is, but I enjoyed it. Content: Cannibalism. Plague/infection. Brutal descriptions of injury and self ...

    Actual rating 4.5 stars. I have read a slew of post-apocalyptic novels in which a deadly virus has wreaked havoc and culled the majority of our species. What ordinarily happens is that a portion of humanity devolves into zombie-like creatures, another into opportunistic gangs, and a...

    Checkout my full review + giveaway (ends 11/12) on my blog! http://omgbooksandmorebooks.blogspot.... THIS BOOK! In my opinion this should be required reading for science classes because the science level in this book is beyond from what I've seen in any YA book. It's amazing. The ca...

  • Dannii Elle
    Sep 03, 2017

    Emily Suvada has written a brilliant dystopian science fiction thriller set in a future where humanity is threatened by a deadly plague that has people exploding into toxic Hydra clouds. Catarina Agatta is a talented hacker, 'bobcat', working with The Skies resistance movement against ...

    2 1/2 stars. This was? interesting, and also not my type of book, and kind of disappointing. I honestly think This Mortal Coil is bit of your typical plot-twisty-but-not-very-quality YA sci-fi , and although some things stood out, I just didn?t love it. The obvious upside of th...

    ?There?s no such thing quite as dangerous as an Agatta?s best intentions.? The beginning was intense and fast-paced but as it went on, the book really lost stream. Of course the length doesn?t help (420 pages) but it went off the rail for me when her martyrdom kicked in. I...

    3.5* A world where a disease has taken over and people have tech installed in their bodies. It's fast paced, action packed, heavy on romance, and decently entertaining. Cool and unique world. I want to make it clear that it's DECENTLY ENTERTAINING and that there are a ton of books t...

    ((2.5 stars, rounded up for THAT plot twist)) hoo boy this is going to be a bitch of a review to write. i don't think i've ever been so conflicted about a book in a while. i'll start with the stuff i liked first. the plot and the concept was excellent. there have been no shorta...

    Who is this cover and where can I marry it???? ...

    This book was fantastic! At first, it seemed a bit cliched and stuff, but then it picked up and I couldn't put it down Genetics, coding, technology, big plot twists, fast paced, everything you could want in a sci-fi book Y you can tell the author researched it all and knew what ...

    I finished this book a while ago and totally forgot to write a review for it OOPS ITS FINE Basically, this book was beyond fun and sooOoOO interesting guys. It gave me slight The Darkest Minds vibes and I?m not really sure why it just did xD it?s like a sci-fi tech version of T...

    A great science fiction blend of post apocalyptic survival and genetic technology. It's like Warcross meets The Walking Dead. At times I thought this was just plain weird, and it is, but I enjoyed it. Content: Cannibalism. Plague/infection. Brutal descriptions of injury and self ...

    Actual rating 4.5 stars. I have read a slew of post-apocalyptic novels in which a deadly virus has wreaked havoc and culled the majority of our species. What ordinarily happens is that a portion of humanity devolves into zombie-like creatures, another into opportunistic gangs, and a...

  • Emma♔☯ (Bookishfix)
    Apr 17, 2018

    Emily Suvada has written a brilliant dystopian science fiction thriller set in a future where humanity is threatened by a deadly plague that has people exploding into toxic Hydra clouds. Catarina Agatta is a talented hacker, 'bobcat', working with The Skies resistance movement against ...

    2 1/2 stars. This was? interesting, and also not my type of book, and kind of disappointing. I honestly think This Mortal Coil is bit of your typical plot-twisty-but-not-very-quality YA sci-fi , and although some things stood out, I just didn?t love it. The obvious upside of th...

    ?There?s no such thing quite as dangerous as an Agatta?s best intentions.? The beginning was intense and fast-paced but as it went on, the book really lost stream. Of course the length doesn?t help (420 pages) but it went off the rail for me when her martyrdom kicked in. I...

    3.5* A world where a disease has taken over and people have tech installed in their bodies. It's fast paced, action packed, heavy on romance, and decently entertaining. Cool and unique world. I want to make it clear that it's DECENTLY ENTERTAINING and that there are a ton of books t...

    ((2.5 stars, rounded up for THAT plot twist)) hoo boy this is going to be a bitch of a review to write. i don't think i've ever been so conflicted about a book in a while. i'll start with the stuff i liked first. the plot and the concept was excellent. there have been no shorta...

    Who is this cover and where can I marry it???? ...

    This book was fantastic! At first, it seemed a bit cliched and stuff, but then it picked up and I couldn't put it down Genetics, coding, technology, big plot twists, fast paced, everything you could want in a sci-fi book Y you can tell the author researched it all and knew what ...

    I finished this book a while ago and totally forgot to write a review for it OOPS ITS FINE Basically, this book was beyond fun and sooOoOO interesting guys. It gave me slight The Darkest Minds vibes and I?m not really sure why it just did xD it?s like a sci-fi tech version of T...

    A great science fiction blend of post apocalyptic survival and genetic technology. It's like Warcross meets The Walking Dead. At times I thought this was just plain weird, and it is, but I enjoyed it. Content: Cannibalism. Plague/infection. Brutal descriptions of injury and self ...

    Actual rating 4.5 stars. I have read a slew of post-apocalyptic novels in which a deadly virus has wreaked havoc and culled the majority of our species. What ordinarily happens is that a portion of humanity devolves into zombie-like creatures, another into opportunistic gangs, and a...

    Checkout my full review + giveaway (ends 11/12) on my blog! http://omgbooksandmorebooks.blogspot.... THIS BOOK! In my opinion this should be required reading for science classes because the science level in this book is beyond from what I've seen in any YA book. It's amazing. The ca...

    this was much better than I expected (sorry for saying nothing else about this book but I currently have no power and shitty reception and an injured dog so that?s all for now) ...

    THIS REVIEW (AND MANY OTHERS) ARE ON MY BLOG Thank you Penguin Australia for sending me a review copy. All thoughts are my own. R A M B L E I went into this book with some low expectations. I?m not exactly sure why. I had requested it from Penguin a few months prior and had ...

    I received a copy of this book in exchange for an honest review. 3.5 stars. If your father was responsible for the apocalypse would you try to set it right? That's the dilemma Catarina faces when a mysterious man shows up at her cabin after a virus wiped out most of humanity, and...

    The earth is a desolate wasteland, a virus decimating humanity, survivors abandoned to starvation. Catarina Agatta is a survivor. Catarina is the seventeen year old daughter of the renowned geneticist Lachlan Agatta, a magnate and former Cartaxus programmer and genetic engineer, now re...

    Not bad at all. Was so into this book but there was so much underlying and bringing the girl Cole is missing up that you have a feeling what is coming when the big twist is revealed. As for some of the other characters, I honestly had a love hate with some, like Dax. However, this was ...

    4.5 stars Excellent. I loved the worldbuilding with all the built-in tech that people have for "genehacking". It was both brilliant and scary. The story was exciting and fast-paced, and I didn't see the ending coming. I'm absolutely in for the next book. ...

    Ahhhhh..... well this seems to be a polarizing kind of book. My GR feed: "This book is my favorite/coolest sci-fi of this year/all time" Also my GR feed: "This has flat characters and a love triangle and is very slow..." What to do? Try it I guess.... So I did and I dislike virus bo...

    4.5 stars Wow, this was a blast! (You know, because the Hydra virus makes you blow up and stuff? ... no? Screw you, that was funny.) This Mortal Coil was such an insane ride from start to finish. It was wild, it was gruesome, it was bloody and fantastic and bloody fantastic. You ...

    3.5 stars - I loved the plot - it did feel like your average dystopian, but the idea of the virus was so original and the plot twists and tech made it feel different - the twists and turns kept you wanting to read more and more - the tech was so so cool? I loved reading about tha...

    why do authors always ruin great premises with instalove and tropes ?? ...

    I did really enjoy this book and can't wait to pick up the next book. Something I did struggle with was getting into the story. There were times where I was 100% invested in the story but there were times where I wasn't. ...

    TCAGACATACGAGTAATGGATTACAGGTGCGAAGCTGTGGATGTAATAAGGCCATCACGACCGCTGGGACTCATCTATATAGCCATGCACGAGGCCAAGTATAATCCACCAGTCCCACAGACCTTAGCACCAGTTAAAGATAATTGGTACCAACCACCGGTGGCAAGATAGATTATTGCCTTCAAGCAACTCTCCATTAGTGCTACTTACGTCATCACGTGGGATCGTACGCTAGTTTACTAGTTTAATGAGTGGTTGCTGTACTGGCATGGTCGTCAACACGGTC...

    This Mortal Coil by Emily Suvada is a refreshing new dystopia/sci-fi/post-apocalyptic story that grabbed me from the start until the very end, and left me gaspingwith the many twists and turns. What immediately grabbed me from the start and impressed me was the writing style. Fr...

    There?s no gene for Run Like Hell? Or is there? Stop the presses I?ve found my new YA trilogy obsession with Emily Suvada?s ?This Mortal Coil? a fast paced, intricately woven, brilliantly fascinating and best of all intelligent and addictive thriller. Actually I?...

    BANG! Did that roller coaster just stop for a while? Woah! I wasn't prepared for such a fantastically written sci-fi thriller. This book got everything. To name a few, I experienced some razor sharp action, last minute escapes, a lot of seriously great plot twists, powerful dialogues...

    It's been a long time since a book has set my soul ablaze, leaving me anxious to devour its pages but wanting to savor every word. I loved this book with every ounce of my being: this is the epitome of why I love the science fiction genre all wrapped up into one. Fantastically written ...

    ?There?s no such thing as right anymore - that ended when the plague hit. Sometimes we need to do awful things to stop worse things from happening. You?re still thinking in terms of right and wrong, but this is war, and the rules have changed.? This was an interesting no...

  • Waqar Arif
    Jun 13, 2018

    Emily Suvada has written a brilliant dystopian science fiction thriller set in a future where humanity is threatened by a deadly plague that has people exploding into toxic Hydra clouds. Catarina Agatta is a talented hacker, 'bobcat', working with The Skies resistance movement against ...

    2 1/2 stars. This was? interesting, and also not my type of book, and kind of disappointing. I honestly think This Mortal Coil is bit of your typical plot-twisty-but-not-very-quality YA sci-fi , and although some things stood out, I just didn?t love it. The obvious upside of th...

    ?There?s no such thing quite as dangerous as an Agatta?s best intentions.? The beginning was intense and fast-paced but as it went on, the book really lost stream. Of course the length doesn?t help (420 pages) but it went off the rail for me when her martyrdom kicked in. I...

    3.5* A world where a disease has taken over and people have tech installed in their bodies. It's fast paced, action packed, heavy on romance, and decently entertaining. Cool and unique world. I want to make it clear that it's DECENTLY ENTERTAINING and that there are a ton of books t...

    ((2.5 stars, rounded up for THAT plot twist)) hoo boy this is going to be a bitch of a review to write. i don't think i've ever been so conflicted about a book in a while. i'll start with the stuff i liked first. the plot and the concept was excellent. there have been no shorta...

    Who is this cover and where can I marry it???? ...

    This book was fantastic! At first, it seemed a bit cliched and stuff, but then it picked up and I couldn't put it down Genetics, coding, technology, big plot twists, fast paced, everything you could want in a sci-fi book Y you can tell the author researched it all and knew what ...

    I finished this book a while ago and totally forgot to write a review for it OOPS ITS FINE Basically, this book was beyond fun and sooOoOO interesting guys. It gave me slight The Darkest Minds vibes and I?m not really sure why it just did xD it?s like a sci-fi tech version of T...

    A great science fiction blend of post apocalyptic survival and genetic technology. It's like Warcross meets The Walking Dead. At times I thought this was just plain weird, and it is, but I enjoyed it. Content: Cannibalism. Plague/infection. Brutal descriptions of injury and self ...

    Actual rating 4.5 stars. I have read a slew of post-apocalyptic novels in which a deadly virus has wreaked havoc and culled the majority of our species. What ordinarily happens is that a portion of humanity devolves into zombie-like creatures, another into opportunistic gangs, and a...

    Checkout my full review + giveaway (ends 11/12) on my blog! http://omgbooksandmorebooks.blogspot.... THIS BOOK! In my opinion this should be required reading for science classes because the science level in this book is beyond from what I've seen in any YA book. It's amazing. The ca...

    this was much better than I expected (sorry for saying nothing else about this book but I currently have no power and shitty reception and an injured dog so that?s all for now) ...

    THIS REVIEW (AND MANY OTHERS) ARE ON MY BLOG Thank you Penguin Australia for sending me a review copy. All thoughts are my own. R A M B L E I went into this book with some low expectations. I?m not exactly sure why. I had requested it from Penguin a few months prior and had ...

    I received a copy of this book in exchange for an honest review. 3.5 stars. If your father was responsible for the apocalypse would you try to set it right? That's the dilemma Catarina faces when a mysterious man shows up at her cabin after a virus wiped out most of humanity, and...

    The earth is a desolate wasteland, a virus decimating humanity, survivors abandoned to starvation. Catarina Agatta is a survivor. Catarina is the seventeen year old daughter of the renowned geneticist Lachlan Agatta, a magnate and former Cartaxus programmer and genetic engineer, now re...

    Not bad at all. Was so into this book but there was so much underlying and bringing the girl Cole is missing up that you have a feeling what is coming when the big twist is revealed. As for some of the other characters, I honestly had a love hate with some, like Dax. However, this was ...

    4.5 stars Excellent. I loved the worldbuilding with all the built-in tech that people have for "genehacking". It was both brilliant and scary. The story was exciting and fast-paced, and I didn't see the ending coming. I'm absolutely in for the next book. ...

    Ahhhhh..... well this seems to be a polarizing kind of book. My GR feed: "This book is my favorite/coolest sci-fi of this year/all time" Also my GR feed: "This has flat characters and a love triangle and is very slow..." What to do? Try it I guess.... So I did and I dislike virus bo...

    4.5 stars Wow, this was a blast! (You know, because the Hydra virus makes you blow up and stuff? ... no? Screw you, that was funny.) This Mortal Coil was such an insane ride from start to finish. It was wild, it was gruesome, it was bloody and fantastic and bloody fantastic. You ...

    3.5 stars - I loved the plot - it did feel like your average dystopian, but the idea of the virus was so original and the plot twists and tech made it feel different - the twists and turns kept you wanting to read more and more - the tech was so so cool? I loved reading about tha...

    why do authors always ruin great premises with instalove and tropes ?? ...

    I did really enjoy this book and can't wait to pick up the next book. Something I did struggle with was getting into the story. There were times where I was 100% invested in the story but there were times where I wasn't. ...

    TCAGACATACGAGTAATGGATTACAGGTGCGAAGCTGTGGATGTAATAAGGCCATCACGACCGCTGGGACTCATCTATATAGCCATGCACGAGGCCAAGTATAATCCACCAGTCCCACAGACCTTAGCACCAGTTAAAGATAATTGGTACCAACCACCGGTGGCAAGATAGATTATTGCCTTCAAGCAACTCTCCATTAGTGCTACTTACGTCATCACGTGGGATCGTACGCTAGTTTACTAGTTTAATGAGTGGTTGCTGTACTGGCATGGTCGTCAACACGGTC...

    This Mortal Coil by Emily Suvada is a refreshing new dystopia/sci-fi/post-apocalyptic story that grabbed me from the start until the very end, and left me gaspingwith the many twists and turns. What immediately grabbed me from the start and impressed me was the writing style. Fr...

    There?s no gene for Run Like Hell? Or is there? Stop the presses I?ve found my new YA trilogy obsession with Emily Suvada?s ?This Mortal Coil? a fast paced, intricately woven, brilliantly fascinating and best of all intelligent and addictive thriller. Actually I?...

    BANG! Did that roller coaster just stop for a while? Woah! I wasn't prepared for such a fantastically written sci-fi thriller. This book got everything. To name a few, I experienced some razor sharp action, last minute escapes, a lot of seriously great plot twists, powerful dialogues...

  • Elise (TheBookishActress)
    Feb 18, 2018

    Emily Suvada has written a brilliant dystopian science fiction thriller set in a future where humanity is threatened by a deadly plague that has people exploding into toxic Hydra clouds. Catarina Agatta is a talented hacker, 'bobcat', working with The Skies resistance movement against ...

    2 1/2 stars. This was? interesting, and also not my type of book, and kind of disappointing. I honestly think This Mortal Coil is bit of your typical plot-twisty-but-not-very-quality YA sci-fi , and although some things stood out, I just didn?t love it. The obvious upside of th...

  • Cindy
    Mar 29, 2018

    Emily Suvada has written a brilliant dystopian science fiction thriller set in a future where humanity is threatened by a deadly plague that has people exploding into toxic Hydra clouds. Catarina Agatta is a talented hacker, 'bobcat', working with The Skies resistance movement against ...

    2 1/2 stars. This was? interesting, and also not my type of book, and kind of disappointing. I honestly think This Mortal Coil is bit of your typical plot-twisty-but-not-very-quality YA sci-fi , and although some things stood out, I just didn?t love it. The obvious upside of th...

    ?There?s no such thing quite as dangerous as an Agatta?s best intentions.? The beginning was intense and fast-paced but as it went on, the book really lost stream. Of course the length doesn?t help (420 pages) but it went off the rail for me when her martyrdom kicked in. I...

    3.5* A world where a disease has taken over and people have tech installed in their bodies. It's fast paced, action packed, heavy on romance, and decently entertaining. Cool and unique world. I want to make it clear that it's DECENTLY ENTERTAINING and that there are a ton of books t...

    ((2.5 stars, rounded up for THAT plot twist)) hoo boy this is going to be a bitch of a review to write. i don't think i've ever been so conflicted about a book in a while. i'll start with the stuff i liked first. the plot and the concept was excellent. there have been no shorta...

    Who is this cover and where can I marry it???? ...

    This book was fantastic! At first, it seemed a bit cliched and stuff, but then it picked up and I couldn't put it down Genetics, coding, technology, big plot twists, fast paced, everything you could want in a sci-fi book Y you can tell the author researched it all and knew what ...

    I finished this book a while ago and totally forgot to write a review for it OOPS ITS FINE Basically, this book was beyond fun and sooOoOO interesting guys. It gave me slight The Darkest Minds vibes and I?m not really sure why it just did xD it?s like a sci-fi tech version of T...

    A great science fiction blend of post apocalyptic survival and genetic technology. It's like Warcross meets The Walking Dead. At times I thought this was just plain weird, and it is, but I enjoyed it. Content: Cannibalism. Plague/infection. Brutal descriptions of injury and self ...

    Actual rating 4.5 stars. I have read a slew of post-apocalyptic novels in which a deadly virus has wreaked havoc and culled the majority of our species. What ordinarily happens is that a portion of humanity devolves into zombie-like creatures, another into opportunistic gangs, and a...

    Checkout my full review + giveaway (ends 11/12) on my blog! http://omgbooksandmorebooks.blogspot.... THIS BOOK! In my opinion this should be required reading for science classes because the science level in this book is beyond from what I've seen in any YA book. It's amazing. The ca...

    this was much better than I expected (sorry for saying nothing else about this book but I currently have no power and shitty reception and an injured dog so that?s all for now) ...

    THIS REVIEW (AND MANY OTHERS) ARE ON MY BLOG Thank you Penguin Australia for sending me a review copy. All thoughts are my own. R A M B L E I went into this book with some low expectations. I?m not exactly sure why. I had requested it from Penguin a few months prior and had ...

    I received a copy of this book in exchange for an honest review. 3.5 stars. If your father was responsible for the apocalypse would you try to set it right? That's the dilemma Catarina faces when a mysterious man shows up at her cabin after a virus wiped out most of humanity, and...

    The earth is a desolate wasteland, a virus decimating humanity, survivors abandoned to starvation. Catarina Agatta is a survivor. Catarina is the seventeen year old daughter of the renowned geneticist Lachlan Agatta, a magnate and former Cartaxus programmer and genetic engineer, now re...

    Not bad at all. Was so into this book but there was so much underlying and bringing the girl Cole is missing up that you have a feeling what is coming when the big twist is revealed. As for some of the other characters, I honestly had a love hate with some, like Dax. However, this was ...

    4.5 stars Excellent. I loved the worldbuilding with all the built-in tech that people have for "genehacking". It was both brilliant and scary. The story was exciting and fast-paced, and I didn't see the ending coming. I'm absolutely in for the next book. ...

    Ahhhhh..... well this seems to be a polarizing kind of book. My GR feed: "This book is my favorite/coolest sci-fi of this year/all time" Also my GR feed: "This has flat characters and a love triangle and is very slow..." What to do? Try it I guess.... So I did and I dislike virus bo...

    4.5 stars Wow, this was a blast! (You know, because the Hydra virus makes you blow up and stuff? ... no? Screw you, that was funny.) This Mortal Coil was such an insane ride from start to finish. It was wild, it was gruesome, it was bloody and fantastic and bloody fantastic. You ...

    3.5 stars - I loved the plot - it did feel like your average dystopian, but the idea of the virus was so original and the plot twists and tech made it feel different - the twists and turns kept you wanting to read more and more - the tech was so so cool? I loved reading about tha...

  • Caitlin
    Jun 21, 2017

    Emily Suvada has written a brilliant dystopian science fiction thriller set in a future where humanity is threatened by a deadly plague that has people exploding into toxic Hydra clouds. Catarina Agatta is a talented hacker, 'bobcat', working with The Skies resistance movement against ...

    2 1/2 stars. This was? interesting, and also not my type of book, and kind of disappointing. I honestly think This Mortal Coil is bit of your typical plot-twisty-but-not-very-quality YA sci-fi , and although some things stood out, I just didn?t love it. The obvious upside of th...

    ?There?s no such thing quite as dangerous as an Agatta?s best intentions.? The beginning was intense and fast-paced but as it went on, the book really lost stream. Of course the length doesn?t help (420 pages) but it went off the rail for me when her martyrdom kicked in. I...

    3.5* A world where a disease has taken over and people have tech installed in their bodies. It's fast paced, action packed, heavy on romance, and decently entertaining. Cool and unique world. I want to make it clear that it's DECENTLY ENTERTAINING and that there are a ton of books t...

    ((2.5 stars, rounded up for THAT plot twist)) hoo boy this is going to be a bitch of a review to write. i don't think i've ever been so conflicted about a book in a while. i'll start with the stuff i liked first. the plot and the concept was excellent. there have been no shorta...

    Who is this cover and where can I marry it???? ...

    This book was fantastic! At first, it seemed a bit cliched and stuff, but then it picked up and I couldn't put it down Genetics, coding, technology, big plot twists, fast paced, everything you could want in a sci-fi book Y you can tell the author researched it all and knew what ...

    I finished this book a while ago and totally forgot to write a review for it OOPS ITS FINE Basically, this book was beyond fun and sooOoOO interesting guys. It gave me slight The Darkest Minds vibes and I?m not really sure why it just did xD it?s like a sci-fi tech version of T...

    A great science fiction blend of post apocalyptic survival and genetic technology. It's like Warcross meets The Walking Dead. At times I thought this was just plain weird, and it is, but I enjoyed it. Content: Cannibalism. Plague/infection. Brutal descriptions of injury and self ...

    Actual rating 4.5 stars. I have read a slew of post-apocalyptic novels in which a deadly virus has wreaked havoc and culled the majority of our species. What ordinarily happens is that a portion of humanity devolves into zombie-like creatures, another into opportunistic gangs, and a...

    Checkout my full review + giveaway (ends 11/12) on my blog! http://omgbooksandmorebooks.blogspot.... THIS BOOK! In my opinion this should be required reading for science classes because the science level in this book is beyond from what I've seen in any YA book. It's amazing. The ca...

    this was much better than I expected (sorry for saying nothing else about this book but I currently have no power and shitty reception and an injured dog so that?s all for now) ...

  • Alice Cai
    Sep 24, 2017

    Emily Suvada has written a brilliant dystopian science fiction thriller set in a future where humanity is threatened by a deadly plague that has people exploding into toxic Hydra clouds. Catarina Agatta is a talented hacker, 'bobcat', working with The Skies resistance movement against ...

    2 1/2 stars. This was? interesting, and also not my type of book, and kind of disappointing. I honestly think This Mortal Coil is bit of your typical plot-twisty-but-not-very-quality YA sci-fi , and although some things stood out, I just didn?t love it. The obvious upside of th...

    ?There?s no such thing quite as dangerous as an Agatta?s best intentions.? The beginning was intense and fast-paced but as it went on, the book really lost stream. Of course the length doesn?t help (420 pages) but it went off the rail for me when her martyrdom kicked in. I...

    3.5* A world where a disease has taken over and people have tech installed in their bodies. It's fast paced, action packed, heavy on romance, and decently entertaining. Cool and unique world. I want to make it clear that it's DECENTLY ENTERTAINING and that there are a ton of books t...